WormMine: Gene WBGene00004063

• WormBase Gene ID: WBGene00004063
• Gene Name: pmr-1
• Sequence Name: ZK256.1
• Brief Description: The pmr-1 gene encodes a Golgi P-type ATPase Ca^2+/Mn^2+-pump; mutations in its human ortholog, ATP2C1, cause Hailey-Hailey disease (OMIM:169600).
• Organism: Caenorhabditis elegans
• Automated Description: Enables P-type calcium transporter activity and P-type manganese transporter activity. Involved in several processes, including metal ion transport; response to metal ion; and response to oxidative stress. Located in Golgi apparatus and membrane. Expressed in male gonad; seam cell; and spermatheca. Human ortholog(s) of this gene implicated in Hailey-Hailey disease. Is an ortholog of human ATP2C1 (ATPase secretory pathway Ca2+ transporting 1) and ATP2C2 (ATPase secretory pathway Ca2+ transporting 2).
• Biotype: SO:0001217
• Genetic Position: I :17.0977 ±0.064933
• Length (nt): 19188

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00004063

Genomics

5 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:ZK256.1a.1	ZK256.1a.1	3263	I: 13004437-13023592
Transcript:ZK256.1a.2	ZK256.1a.2	3303	I: 13011428-13023624
Transcript:ZK256.1a.3	ZK256.1a.3	3393	I: 13011428-13023624
Transcript:ZK256.1c.1	ZK256.1c.1	2937	I: 13011462-13023292
Transcript:ZK256.1b.1	ZK256.1b.1	2192	I: 13012220-13021005

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:ZK256.1c	ZK256.1c	2937	I: 13011462-13011500
CDS:ZK256.1a	ZK256.1a	2706	I: 13012220-13012531
CDS:ZK256.1b	ZK256.1b	2118	I: 13012220-13012531

8 RNAi Result

• WBRNAi00059303
• WBRNAi00038238
• WBRNAi00059917
• WBRNAi00059919
• WBRNAi00059920
• WBRNAi00059921
• WBRNAi00116858
• WBRNAi00086175

285 Allele

• gk963849
• gk964175
• h7311
• h7151
• h16100
• h13890
• h5508
• otn9390
• WBVar01434137
• WBVar01434126
• WBVar01434127
• WBVar01434128
• WBVar01434129
• WBVar01434133
• WBVar01434134
• WBVar01434135
• WBVar01434136
• WBVar01434130
• WBVar01434131
• WBVar02028532
• WBVar02028531
• otn1242
• otn1244
• otn1243
• WBVar01826474
• WBVar01762432
• WBVar01500565
• WBVar01500567
• WBVar01500566
• WBVar01500569

1 Chromosome

• WormBase ID: I
• Organism: Caenorhabditis elegans
• Length (nt): 15072434

1 Chromosome Location

• Feature . Primary Identifier: WBGene00004063
• Start: 13004437
• End: 13023624
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrI_13023625..13033482
• Length (nt): 9858
• Chromosome Location: I: 13023625-13033482
• Organism: Caenorhabditis elegans

115 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts that showed significantly increased expression in hrde-1(tm1200) animals, comparing to in N2, after growing at 25C for five generations (late generation).	CuffDiff2	WBPaper00051265:F4_hrde-1(tm1200)_upregulated
	Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_SM
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
	Transcripts that showed significantly increased expression in clk-1(qm30) comparing to in N2.	Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1.	WBPaper00053810:clk-1(qm30)_upregulated
	Transcripts that showed significantly increased expression in isp-1(qm150) comparing to in N2.	Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1.	WBPaper00053810:isp-1(qm150)_upregulated
	Transcripts that showed significantly increased expression in nuo-6(qm200) comparing to in N2.	Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1.	WBPaper00053810:nuo-6(qm200)_upregulated
	Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Allantoin_downregulated
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
	Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis.	To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq.	WBPaper00045521:Gender_Neutral
	Proteins identified in extracellular vesicle.	N.A.	WBPaper00062669:extracellular-vesicle_protein
	Transcripts that showed significantly decreased expression in nhl-2(ok818) comparing to in N2 at 25C.	EdgeR, FDR < 0.05, fold change < 0.5.	WBPaper00055971:nhl-2(ok818)_25C_upregulated
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_downregulated
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2 at early embryo stage.	DESeq2, FDR < 0.05	WBPaper00058691:sin-3(tm1276)_upregulated
	Genes expressed in N2.	Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0.	WBPaper00025141:N2_Expressed_Genes
EtBr-exposed(maintained under normal lab light (mostly dark, in incubators) and exposed to EtBr (5ug/mL in agar).) vs UVC-exposed(exposed to 7.5 J/m2 UVC radiation 3 times, 24 h apart (48 h total).) at 3 h after the third UVC dose (51h), which is also 3 h after being placed on food.	Genes differentially expressed under EtBr treatment without UVC exposure vs after UVC exposure but without EtBr treatment at the -3h timepoint (3 h after the third UVC dose (51h), which is also 3 h after being placed on food).	Transcripts were defined as fold-change >1.2, p < 0.05 based on Rosetta Resolver analysis for all pairwise treatment comparisons. The fold-change refers to the second intensity over the first.	WBPaper00041939:EtBr-exposed_vs_UVC-exposed_51h
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (FLT) starting at L1 lava stage.	DESeq	WBPaper00053302:alovudine_24h_regulated
	Transcripts that showed significantly increased expression in jmjd-3.1p::jmjd-3.1 comparing to in N2.	DESeq2 Benjamini-Hochberg adjusted p-value < 0.05.	WBPaper00049545:jmjd-3.1(+)_upregulated
	Transcripts that showed significantly increased expression in rgef-1p::jmjd-1.2 comparing to in N2.	DESeq2 Benjamini-Hochberg adjusted p-value < 0.05.	WBPaper00049545:rgef-1p-jmjd-1.2(+)_upregulated

8 Expression Patterns

• Primary Identifier: Expr1031961
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr1162731
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr7200
• Remark: Strain: BC13693
• Reporter Gene: [pmr-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCTATTTTTGTGATGACTGGGAGA] 3' and primer B 5' [TCGTCTTTTGATATTGATTTTGAA] 3'.
• Pattern: Adult Expression: Nervous System; head neurons; Larval Expression: pharyngeal-intestinal valve; intestine; Nervous System; head neurons

• Primary Identifier: Expr3187
• Pattern: Transgenic worms containing the pmr-1::gfp construct showed GFP expression beginning as early as 3-fold stage and continued to be expressed throughout larval and adult stages. Expression was spatially confined to hypodermal seam cells, spermatheca, and intestine. When pPMR pro & cDNA::gfp was injected, transgenic worm showed essentially the same expression pattern, but different subcellular localization. Taken together, CePMR-1 is expressed in hypodermal seam cells, intestinal cells and spermatheca and male gonad; subcellularly it is localized at Golgi complex.
• Subcellular Localization: The GFP was found to be highly diffused in the worms harboring pPMR pro::gfp, but in worms expressing pPMR pro & cDNA::gfp, GFP appeared to be punctated and was confined to cytosolic region. This difference is likely to reflect the differences in the sub-cellular localization. pPMR pro::manII DsRed was injected into the transgenic worm already expressing CePMR-1::GFP fusion protein. The pPMR pro::manII DsRed, which encodes a part of alpha mannosidase II (a Golgi resident protein), was expressed under the control of pmr-1 promoter. The localization of CePMR-1 is completely superimposable with that of mannosidase, confirming the localization of CePMR-1 at Golgi apparatus. Similar pattern was observed in intestine and spermatheca.

• Primary Identifier: Expr2014977
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Chronogram1105
• Remark: Original chronogram file: chronogram.2228.xml
• Reporter Gene: [ZK256.1:gfp] transcriptional fusion.

• Primary Identifier: Expr1017781
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2033212
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

33 GO Annotation

8 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00004063
• Start: 13004437
• End: 13023624
• Strand: 1

33 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 19188

1 Sequence Ontology Term

• Name: gene

0 Strains

0 Upstream Intergenic Region