Genomics
11 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:F54E2.3e.1 | F54E2.3e.1 |
15309
 |
V: 2781939-2807860 |
| Transcript:F54E2.3a.1 | F54E2.3a.1 |
13388
|
V: 2781943-2800220 |
| Transcript:F54E2.3d.1 | F54E2.3d.1 |
12990
|
V: 2781984-2800220 |
| Transcript:F54E2.3l.1 | F54E2.3l.1 |
9783
|
V: 2782578-2794344 |
| Transcript:F54E2.3k.1 | F54E2.3k.1 |
10194
|
V: 2782578-2795937 |
| Transcript:F54E2.3c.1 | F54E2.3c.1 |
12630
|
V: 2782578-2800220 |
| Transcript:F54E2.3i.1 | F54E2.3i.1 |
12975
|
V: 2782578-2800220 |
| Transcript:F54E2.3j.1 | F54E2.3j.1 |
12852
|
V: 2782578-2800220 |
| Transcript:F54E2.3f.1 | F54E2.3f.1 |
14547
|
V: 2782578-2807860 |
| Transcript:F54E2.3g.1 | F54E2.3g.1 |
14892
|
V: 2782578-2807860 |
| Transcript:F54E2.3h.1 | F54E2.3h.1 |
14769
|
V: 2782578-2807860 |
Other
11 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:F54E2.3e | F54E2.3e |
14670
|
V: 2782578-2782585 |
| CDS:F54E2.3l | F54E2.3l |
9783
|
V: 2782578-2782585 |
| CDS:F54E2.3k | F54E2.3k |
10194
|
V: 2782578-2782585 |
| CDS:F54E2.3c | F54E2.3c |
12630
|
V: 2782578-2782585 |
| CDS:F54E2.3g | F54E2.3g |
14892
|
V: 2782578-2782585 |
| CDS:F54E2.3h | F54E2.3h |
14769
|
V: 2782578-2782585 |
| CDS:F54E2.3a | F54E2.3a |
12753
|
V: 2782578-2782585 |
| CDS:F54E2.3d | F54E2.3d |
12396
|
V: 2782578-2782585 |
| CDS:F54E2.3f | F54E2.3f |
14547
|
V: 2782578-2782585 |
| CDS:F54E2.3i | F54E2.3i |
12975
|
V: 2782578-2782585 |
| CDS:F54E2.3j | F54E2.3j |
12852
|
V: 2782578-2782585 |
28 RNAi Result
547 Allele
| Public Name |
|---|
| WBVar01585850 |
| WBVar01585851 |
| WBVar01585852 |
| WBVar01585853 |
| WBVar01585854 |
| WBVar01585855 |
| WBVar01585856 |
| WBVar01585857 |
| WBVar01585858 |
| WBVar01585859 |
| WBVar01585860 |
| WBVar01585861 |
| WBVar01585862 |
| WBVar01585863 |
| WBVar01585864 |
| WBVar01585865 |
| WBVar01585866 |
| WBVar01585867 |
| WBVar01585868 |
| WBVar01585800 |
| WBVar01585801 |
| WBVar01585802 |
| WBVar01585803 |
| WBVar01585804 |
| WBVar01585805 |
| WBVar01585806 |
| WBVar01585807 |
| WBVar01585808 |
| WBVar01585809 |
| WBVar01585830 |
1 Chromosome Location
|
Feature . Primary Identifier |
Start | End | Strand |
|---|---|---|---|
| WBGene00004130 | 2781939 | 2807860 | -1 |
3 Data Sets
| Name | URL |
|---|---|
| WormBaseAcedbConverter | |
| GO Annotation data set | |
| C. elegans genomic annotations (GFF3 Gene) |
1 Downstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrV_2780887..2781938 | 1052 | V: 2780887-2781938 | Caenorhabditis elegans |
275 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Genes with expression altered >= 3-fold in dpy-10(e128) mutants. | Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)). | WBPaper00035873:dpy-10_regulated | |
| Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. | DESeq. False discovry rate (FDR) < 0.1. | WBPaper00048988:neuron_expressed | |
| adult vs dauer larva | Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. | N.A. | WBPaper00050488:adult_vs_dauer_regulated_N2_20C |
| TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood. | SAM | WBPaper00031040:TGF-beta_adult_upregulated | |
| Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). | A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. | WBPaper00037950:bodywall-muscle_L1-larva_expressed | |
| Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals. | Fold change > 2, FDR < 0.01. | WBPaper00065993:glp-1(e2141)_upregulated | |
| Bacteria infection: Enterococcus faecalis | Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50. | For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. | WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray |
| Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:arcade_intestinal-valve_expressed | |
| Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:body-muscle_expressed | |
| Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites. | DESeq2, fold change > 2, FDR < 0.05 | WBPaper00065835:Day5_vs_Day1_downregulated | |
| Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:GABAergic-neuron_expressed | |
| Transcripts that showed significantly decreased expression at 11-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites. | DESeq2, fold change > 2, FDR < 0.05 | WBPaper00065835:Day11_vs_Day1_downregulated | |
| Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:hypodermis_expressed | |
| Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:NMDA-neuron_expressed | |
| Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:pharynx_expressed | |
| Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:seam_expressed | |
| Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals. | Fold change > 2, FDR < 0.05 | WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141) | |
| Bacteria diet: Xanthomonas citri Orange. Fed for 30 generations. | Transcripts that showed significantly decreased expression after fed by bacteria Xanthomonas citri (Orange) for 30 generations comparing to animals fed by E. coli OP50. | DESeq2 fold change > 2, p-value < 0.01. | WBPaper00061007:X.citri_downregulated |
| Bacteria infection: Bacillus thuringiensis | Transcripts that showed significantly increased expression in N2 animals infected by bacteria BMB171/Cry5Ba, an acrystalliferous Bt mutant BMB171 transformed with toxin gene cry5Ba on the shuttle vector pHT304, comparing to N2 animals infected by BMB171/pHT304. | N.A. | WBPaper00064229:B.thuringiensis-Cry5Ba_upregulated |
| Bacteria infection: Bacillus thuringiensis | mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq. | Cuffdiff, ajusted p-value < 0.01. | WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h |
| Bacteria infection: Bacillus thuringiensis | mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq. | Cuffdiff, ajusted p-value < 0.01. | WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h |
| Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO. | Fold change > 2. | WBPaper00064306:Agaro-oligosaccharides_upregulated | |
| Bacteria infection: Bacillus thuringiensis | mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq. | Cuffdiff, ajusted p-value < 0.01. | WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h |
| Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. | DESeq2, fold change > 2, p-value < 0.01. | WBPaper00061203:sin-3(tm1276)_upregulated | |
| Bacteria infection: Bacillus thuringiensis | mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq. | Cuffdiff, ajusted p-value < 0.01. | WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h |
| Transcripts that showed significantly increased expression in mrg-1(qa6200) comparing to in control animals in primordial germ cells (PGCs) at L1 larva stage. | DESeq2(v1.32.0), FDR < 0.05. | WBPaper00064315:mrg-1(qa6200)_upregulated_PGCs | |
| Dietary restriction | Transcripts that showed significantly decreased expression after N2 animals were under dietary restriction (DR, OP50 OD = 0.1) from 3-day post L4 till 6-day post L4 adult hermaphrodite stage, comparing to under ad libtum (AL, OP50 OD = 3) condition. | Bioconductor package edgeR, p < 0.05. | WBPaper00056443:DietaryRestriction_downregulated |
| Transcripts that showed significantly increased expression in hrde-1(tm1200) animals, comparing to in N2, after growing at 25C for five generations (late generation). | CuffDiff2 | WBPaper00051265:F4_hrde-1(tm1200)_upregulated | |
| Genes that showed significantly increased expression in daf-2(e1370);hel-1(gk148684) comparing to in hel-1(gk148684) | To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs. | WBPaper00047131:daf-2(e1370)_upregulated_hel-1(gk148684)-background | |
| Genes that showed significantly increased expression in daf-2(e1370) comparing to in N2. | To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs. | WBPaper00047131:daf-2(e1370)_upregulated_N2-background |
14 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Strain: BC14879 | [ketn-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCGAAAGACGAGTGATGTATGA] 3' and primer B 5' [TTTTCTCGATTTTATTTTTGCGA] 3'. | Expr6180 | Adult Expression: pharynx; anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; Larval Expression: pharynx; anal depressor muscle; Reproductive System; developing vulva; body wall muscle; | |
| F54E2 The gene kettin is located on cosmid F54E2 and R05D8, the actual predicted open reading frame is not mentioned in the article. Sequence: R05D8 | Expr980 | Reaction of larvae and adults shows labelling of pharyngeal, body wall, anal depressor, and proximal gonadal muscles of males and hermaphrodites. | ||
| Picture: Figure 3. | Expr7982 | Authors reexamined intracellular localization of Ce-kettin by double or triple staining with other cytoskeletal markers and found that it localized to a portion, not the entire length, of the I-bands. Triple staining of body wall muscle for actin (thin filaments), Ce-kettin (MH44), and myosin heavy chain (thick filaments) confirmed that Ce-kettin is associated with the thin filaments. However, Ce-kettin localized to a ladder-like pattern and its localization was limited to a narrow region in the middle of the bands of actin. Triple staining for actin, Ce-kettin, and vinculin (dense bodies) showed that Ce-kettin has some overlap with vinculin, but the center of the dense bodies was devoid of Ce-kettin. In addition, comparison with the location of tropomyosin showed that tropomyosin localized to the outer region on the thin filaments with minimal overlap with Ce-kettin. These results indicate that Ce-kettin is associated with a portion of the thin filaments near the dense bodies. | ||
| Original chronogram file: chronogram.1022.xml | [F54E2.3:gfp] transcriptional fusion. | Chronogram28 | ||
| Expr1032005 | Tiling arrays expression graphs | |||
| F54E2 The gene: kettin is located on cosmid F54E2 and R05D8, the actual predicted open reading frame is not mentioned in the article. Sequence: R05D8 | Expr979 | kettin RNA is present in the pharyngeal, body wall, and anal depressor muscles. Expression in these muscles is particularly pronounced in larvae and hermaphrodites, relative to that seen in male adults. Kettin RNA is also detected in male-specific structures in the tail. | ||
| Expr1152136 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015 | |||
| Expr1152137 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015 | |||
| Expr2012923 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Expr1014641 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | |||
| Expr1015968 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | |||
| This pattern is inconsistent with the report by Kolmerer and colleagues that a monoclonal antibody against insect kettin recognizes the dense bodies in the C. elegans body wall muscle. Furthermore, the MH44 staining significantly extends into the I-bands towards the A-bands, whereas kettin in insects or crayfish localizes in or near the Z-discs. Therefore, further studies on the localization of C. elegans kettin are needed to determine if these discrepancies are due to different epitopes recognized by the antibodies or inherent unique characteristics of C. elegans kettin that might be adapted to the obliquely striated muscle. | Expr3812 | Kettin co-localized with actin in a ladder-like pattern, but the width of the staining was narrower than the actin bands. Vinculin, a component of the dense bodies, localized to the spots where the kettin staining was very weak or absent. Therefore, kettin is associated with a portion of the thin filaments near the dense bodies, which are equivalent to the Z-discs in cross-striated muscles. | ||
| Expr2031157 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Expr1040153 | Tiling arrays expression graphs |
6 GO Annotation
| Annotation Extension | Qualifier |
|---|---|
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| enables | |
| located_in |
6 Ontology Annotations
| Annotation Extension | Qualifier |
|---|---|
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| enables | |
| located_in |
1 Upstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrV_2807861..2810397 | 2537 | V: 2807861-2810397 | Caenorhabditis elegans |
