WormMine: Gene WBGene00006787

• WormBase Gene ID: WBGene00006787
• Gene Name: unc-52
• Sequence Name: ZC101.2
• Brief Description: The unc-52 gene encodes perlecan, a protein orthologous to human basement membrane-specific heparan sulfate proteoglycan core protein (HSPG2; OMIM:142461, which when mutated leads to Schwartz-Jampel syndrome or dyssegmental dysplasia); UNC-52 plays essential roles in muscle structure development and regulation of growth factor-like signaling pathways; UNC-52 is synthesized by the hypodermis and localizes to the extracellular matrix between hypodermis and muscle.
• Organism: Caenorhabditis elegans
• Automated Description: An extracellular matrix structural constituent. Involved in several processes, including hemidesmosome assembly; muscle cell cellular homeostasis; and muscle structure development. Located in basement membrane and striated muscle dense body. Expressed in alimentary muscle; body wall musculature; gonad; and pharyngeal-intestinal valve. Human ortholog(s) of this gene implicated in several diseases, including Schwartz-Jampel syndrome 1; Silverman-Handmaker type dyssegmental dysplasia; and hyperglycemia. Is an ortholog of human HSPG2 (heparan sulfate proteoglycan 2).
• Biotype: SO:0001217
• Genetic Position: II :23.3333 ±0.020195
• Length (nt): 37136

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00006787

Genomics

17 Transcripts

Class	WormMine ID	Sequence Name	Length (nt)	Chromosome Location
MRNA	Transcript:ZC101.2d.1	ZC101.2d.1	12546	II: 14647321-14684456
MRNA	Transcript:ZC101.2g.1	ZC101.2g.1	2631	II: 14647479-14651037
MRNA	Transcript:ZC101.2e.1	ZC101.2e.1	10128	II: 14647479-14666852
NcPrimaryTranscript	Transcript:ZC101.2q	ZC101.2q	692	II: 14652118-14652809
MRNA	Transcript:ZC101.2a.1	ZC101.2a.1	7968	II: 14652130-14666943
MRNA	Transcript:ZC101.2f.1	ZC101.2f.1	7678	II: 14652141-14666943
MRNA	Transcript:ZC101.2m.1	ZC101.2m.1	7567	II: 14652143-14666852
MRNA	Transcript:ZC101.2n.1	ZC101.2n.1	7582	II: 14652143-14666852
MRNA	Transcript:ZC101.2o.1	ZC101.2o.1	7855	II: 14652143-14666852
MRNA	Transcript:ZC101.2c.1	ZC101.2c.1	7393	II: 14652143-14666942
MRNA	Transcript:ZC101.2i.1	ZC101.2i.1	7096	II: 14652144-14666943
MRNA	Transcript:ZC101.2j.1	ZC101.2j.1	7278	II: 14652150-14666852
MRNA	Transcript:ZC101.2p.1	ZC101.2p.1	414	II: 14652558-14654225
MRNA	Transcript:ZC101.2k.1	ZC101.2k.1	6891	II: 14652558-14666852
MRNA	Transcript:ZC101.2l.1	ZC101.2l.1	6672	II: 14652558-14666942
MRNA	Transcript:ZC101.2r.1	ZC101.2r.1	9816	II: 14652558-14684296
MRNA	Transcript:ZC101.2b.1	ZC101.2b.1	3956	II: 14661264-14666943

Other

16 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:ZC101.2e	ZC101.2e	10128	II: 14647479-14647857
CDS:ZC101.2c	ZC101.2c	6888	II: 14652558-14652809
CDS:ZC101.2f	ZC101.2f	7170	II: 14652558-14652809
CDS:ZC101.2n	ZC101.2n	7167	II: 14652558-14652809
CDS:ZC101.2p	ZC101.2p	414	II: 14652558-14652809
CDS:ZC101.2k	ZC101.2k	6891	II: 14652558-14652809
CDS:ZC101.2r	ZC101.2r	9816	II: 14652558-14652809
CDS:ZC101.2a	ZC101.2a	7449	II: 14652558-14652809
CDS:ZC101.2b	ZC101.2b	3483	II: 14661646-14661937
CDS:ZC101.2d	ZC101.2d	12228	II: 14647479-14647857
CDS:ZC101.2g	ZC101.2g	2631	II: 14647479-14647857
CDS:ZC101.2i	ZC101.2i	6591	II: 14652558-14652809
CDS:ZC101.2j	ZC101.2j	6870	II: 14652558-14652809
CDS:ZC101.2l	ZC101.2l	6582	II: 14652558-14652809
CDS:ZC101.2m	ZC101.2m	7152	II: 14652558-14652809
CDS:ZC101.2o	ZC101.2o	7440	II: 14652558-14652809

85 RNAi Result

• WBRNAi00009435
• WBRNAi00065998
• WBRNAi00083106
• WBRNAi00089732
• WBRNAi00067263
• WBRNAi00067469
• WBRNAi00067537
• WBRNAi00067624
• WBRNAi00067664
• WBRNAi00067767
• WBRNAi00067934
• WBRNAi00067986
• WBRNAi00058716
• WBRNAi00026994
• WBRNAi00073413
• WBRNAi00073412
• WBRNAi00066826
• WBRNAi00068563
• WBRNAi00068562
• WBRNAi00068565
• WBRNAi00068564
• WBRNAi00068566
• WBRNAi00064541
• WBRNAi00064586
• WBRNAi00064736
• WBRNAi00064762
• WBRNAi00064782
• WBRNAi00064850
• WBRNAi00068988
• WBRNAi00021557

706 Allele

• gk963801
• gk963053
• WBVar01320800
• WBVar01320803
• WBVar01320808
• WBVar01320782
• WBVar01320785
• WBVar01320786
• WBVar01320787
• WBVar01320788
• WBVar01320789
• WBVar01320790
• WBVar01320794
• WBVar01320744
• WBVar01320745
• WBVar01320746
• WBVar01320749
• WBVar01320752
• WBVar01320758
• WBVar01320759
• WBVar01320761
• WBVar01320763
• WBVar01320764
• WBVar01320767
• WBVar01320771
• WBVar01320774
• WBVar01320775
• WBVar01320780
• WBVar01320781
• WBVar01320735

1 Chromosome

• WormBase ID: II
• Organism: Caenorhabditis elegans
• Length (nt): 15279421

1 Chromosome Location

• Feature . Primary Identifier: WBGene00006787
• Start: 14647321
• End: 14684456
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrII_14644084..14647320
• Length (nt): 3237
• Chromosome Location: II: 14644084-14647320
• Organism: Caenorhabditis elegans

347 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Genes with expression altered >= 3-fold in dpy-10(e128) mutants.	Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)).	WBPaper00035873:dpy-10_regulated
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Transcripts that showed significantly decreased expression in AGP22 [nhr-49(nr2041)I;glp-1(e2141)III] comparing to in CF1903 [glp-1(e2144)III] at Day 2 adults.	Fold change > 2, p Value of < 0.05 and a false discovery rate (FDR) of < 0.05.	WBPaper00061530:nhr-49(e2144)_downregulated
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_upregulated
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
	Genes that were upregulated in lin-15B(n744).	For each gene in each microarray hybridization experiment, the ratio of RNA levels from the two samples was transformed into a log2 value and the mean log2 ratio was calculated. The log2 ratios were normalized by print-tip Loess normalization (Dudoit and Yang, 2002). All genes with a false discovery rate of <= 5% (q <= 0.05) (Storey and Tibshirani, 2003) and a mean fold-change ratio of >= 1.5 were selected for further analysis.	WBPaper00038168:lin-15B(n744)_upregulated
Bacteria infection: Enterococcus faecalis	Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
	Coexpression clique No. 60, 176662_at-Y53F4B.16, on the genome-wide coexpression clique map for the nematode GPL200 platform.	All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform.	WBPaper00061527:176662_at-Y53F4B.16
	Genes that showed significantly increased expression in wrn-1(gk99) comparing to in N2, according to RNAseq.	DESeq was used to calculate the fold changes, log fold changes, and significance of the changes for each comparison.	WBPaper00045934:wrn-1(gk99)_upregulated
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day5_vs_Day1_downregulated
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts that showed significantly decreased expression at 11-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day11_vs_Day1_downregulated
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Genes up regulated in alg-1(gk214) comparing to in N2.	Differential expression was assessed using an empirical Bayes statistics using the eBayes function.	WBPaper00040823:alg-1(gk214)_upregulated
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at old adults stage (214 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_aging
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_developing
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_regulated_developing
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Genes with expression level regulated by genotype (N2 vs CB4856) at Late reproduction stage (96 hours at 24 centigrade).	Authors permuted transcript values and used a genome-wide threshold of log10 P-value = 2, which resembles a false discovery rate (FDR) of 0.0118.	WBPaper00040858:eQTL_regulated_reproductive
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)

12 Expression Patterns

• Primary Identifier: Expr4552
• Pattern: Expression of major cytoskeletal proteins were detected in the myoepithelial sheath, and, interestingly, some of them were also expressed in other parts of the somatic gonad.

• Primary Identifier: Expr1019668
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1162136
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr1162137
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr7148
• Remark: Strain: BC10819
• Reporter Gene: [unc-52::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCGCTTGCAGTGTCTCAAT] 3' and primer B 5' [GACGACCGCTTGATAGTTCTCTA] 3'.
• Pattern: Adult Expression: pharynx; intestine; anal depressor muscle; Reproductive System; vulval muscle; hypodermis; Larval Expression: pharynx; intestine; anal depressor muscle; hypodermis; unidentified cells

• Primary Identifier: Expr2036021
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1032858
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr1213
• Pattern: Staining is first observed in comma stage embryos and is primarily found at regions of contact between adjacent muscle cells. Some intracellular staining of body-wall muscle cells is also observed, but neither sera stain the underlying hypodermis. Between the comma and 1.5-fold stages, staining spreads from regions of cell-cell contact over the basal face of each muscle cell, where the basement membrane is located. In older embryos, differences in staining are observed with GM1 and GM3. Beginning at the 1.5-fold stage, GM1 stains the posterior end of the pharynx. The anterior pharynx begins to stain somewhat later. By the 3-fold stage, GM1 staining surrounds the pharynx from the anterior margin to the pharyngeal-intestinal valve. GM1 also stains the anal sphincter and depressor muscles at this stage. UNC-52 is specifically associated with contractile tissues in C. elegans and is not found in the basement membranes lining the pseudocoelom or surrounding the intestine. GM3 only stains the body-wall muscles and does not stain the pharynx or anal muscles at any stage of embryonic development. Both GM1 and GM3 stain the body-wall muscles in embryos, larvae, and adults. In larvae and adults, these antisera stain the dense bodies, M-lines, and muscle cell margins, in addition to the basement membrane underlying the muscle quadrants. Both antisera also stain the basement membranes associated with the pharyngeal, anal, and sex-specific muscles in adult animals. GM1 staining of the pharynx, body-wall muscles, and reproductive muscles is shown. UNC-52 is concentrated over focal adhesion-like structures in the pharyngeal muscles. GM1 staining surrounds the pharynx from the anterior margin to the pharyngealintestinal valve, and muscle cells within the terminal bulb stain with a punctate pattern. This punctate staining pattern was not observed in animals prepared by freeze-fracture.

• Primary Identifier: Expr1036192
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr2017885
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1015524
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Chronogram1423
• Remark: Original chronogram file: chronogram.302.xml
• Reporter Gene: [ZC101.2:gfp] transcriptional fusion.

31 GO Annotation

8 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00006787
• Start: 14647321
• End: 14684456
• Strand: -1

31 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 37136

1 Sequence Ontology Term

• Name: gene

294 Strains

• WBStrain00022681
• WBStrain00022528
• WBStrain00022533
• WBStrain00022754
• WBStrain00022735
• WBStrain00022736
• WBStrain00022251
• WBStrain00022166
• WBStrain00022186
• WBStrain00022187
• WBStrain00022473
• WBStrain00023538
• WBStrain00023539
• WBStrain00023540
• WBStrain00023541
• WBStrain00023542
• WBStrain00023547
• WBStrain00023543
• WBStrain00023544
• WBStrain00023545
• WBStrain00023546
• WBStrain00023559
• WBStrain00023561
• WBStrain00023562
• WBStrain00023563
• WBStrain00023564
• WBStrain00023560
• WBStrain00023569
• WBStrain00023565
• WBStrain00023566

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrII_14684457..14688160
• Length (nt): 3704
• Chromosome Location: II: 14684457-14688160
• Organism: Caenorhabditis elegans