WormMine: Gene WBGene00000105

• WormBase Gene ID: WBGene00000105
• Gene Name: alg-1
• Sequence Name: F48F7.1
• Brief Description: alg-1 encodes an Argonaut ortholog; alg-1 is involved in RNA interference and affects developmental timing along with alg-2 and dcr-1 by regulating expression of the lin-4 and let-7 small temporal RNAs.
• Organism: Caenorhabditis elegans
• Automated Description: Enables RNA binding activity and RNA endonuclease activity. Involved in several processes, including regulation of development, heterochronic; regulatory ncRNA-mediated gene silencing; and vulval development. Located in P-body. Part of RISC complex. Expressed in several structures, including P3.p hermaphrodite; P4.p hermaphrodite; gonad; somatic cell; and tail. Human ortholog(s) of this gene implicated in alcohol dependence and glaucoma. Is an ortholog of human AGO2 (argonaute RISC catalytic component 2).
• Biotype: SO:0001217
• Genetic Position: X :15.8406 ±0.103552
• Length (nt): 7152

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00000105

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F48F7.1a.2	F48F7.1a.2	5005	X: 13949110-13956261
Transcript:F48F7.1b.1	F48F7.1b.1	3072	X: 13949489-13954707
Transcript:F48F7.1a.3	F48F7.1a.3	6283	X: 13949571-13956261
Transcript:F48F7.1a.1	F48F7.1a.1	4592	X: 13951262-13956261

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F48F7.1a	F48F7.1a	3009	X: 13951291-13951500
CDS:F48F7.1b	F48F7.1b	3072	X: 13949489-13949522

45 RNAi Result

• WBRNAi00095627
• WBRNAi00087447
• WBRNAi00065485
• WBRNAi00047761
• WBRNAi00008819
• WBRNAi00025553
• WBRNAi00066792
• WBRNAi00094027
• WBRNAi00094535
• WBRNAi00094536
• WBRNAi00064859
• WBRNAi00097789
• WBRNAi00097788
• WBRNAi00087452
• WBRNAi00080900
• WBRNAi00065493
• WBRNAi00086723
• WBRNAi00086730
• WBRNAi00093821
• WBRNAi00093811
• WBRNAi00093774
• WBRNAi00093729
• WBRNAi00094534
• WBRNAi00084646
• WBRNAi00070057
• WBRNAi00080904
• WBRNAi00080903
• WBRNAi00080906
• WBRNAi00080908
• WBRNAi00080910

130 Allele

• gk964260
• gk964029
• gk962707
• gk964028
• gk963810
• gk963581
• gk299859
• gk299860
• gk299861
• gk299862
• gk299857
• gk299858
• gk299863
• gk299864
• gk299865
• gk299866
• gk299870
• gk299871
• gk299872
• gk299873
• gk299867
• gk299868
• gk299869
• gk299874
• gk299875
• gk299852
• gk299853
• gk299854
• gk299855
• gk299856

1 Chromosome

• WormBase ID: X
• Organism: Caenorhabditis elegans
• Length (nt): 17718942

1 Chromosome Location

• Feature . Primary Identifier: WBGene00000105
• Start: 13949110
• End: 13956261
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrX_13956262..13960148
• Length (nt): 3887
• Chromosome Location: X: 13956262-13960148
• Organism: Caenorhabditis elegans

182 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Genes with expression altered >= 3-fold in dpy-10(e128) mutants.	Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)).	WBPaper00035873:dpy-10_regulated
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L1-larva_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:AVE-neuron_L1-larva_expressed
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin_upregulated
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Genes significantly enriched in NSM neurons (isolated by FACS) versus the reference, according to RNAseq analysis towards total RNA.	Gene expression quantification and differential expression was analyzed using cufflinks v2.2.1. Enriched contains only genes significantly enriched (differentially expressed >= 2.4 fold in total RNA or >= 3.2 fold in DSN treated total RNA) in the NSM neurons versus the reference.	WBPaper00045974:NSM_enriched_totalRNA_RNAseq
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage.	edgeR, fold change > 2, FDR < 0.05	WBPaper00060909:atfs-1(cmh15)_downregulated
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_developing
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_regulated_developing
	Transcripts expressed in vulva.	FPKM >= 1.	WBPaper00064122:vulva_transcriptome
	Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO.	Fold change > 2.	WBPaper00064306:Agaro-oligosaccharides_upregulated
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Transcripts that showed significantly increased expression in mrg-1(qa6200) comparing to in control animals in primordial germ cells (PGCs) at L1 larva stage.	DESeq2(v1.32.0), FDR < 0.05.	WBPaper00064315:mrg-1(qa6200)_upregulated_PGCs
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Expression Pattern Group C, enriched for genes involved in metabolic processes.	The significance (P 0.0001) of the relative age (time) was used to determine if a gene was differentially expressed between the three age (time) groups. The effect of this factor explaining gene expression differences was used to determine if the expression went up or down during the two age/time periods (t1 - t2 and t2 -t3). Authors used a permutation approach to determine the thresholds for the different mapping strategies. For each of the used models for eQTL mapping, authors used 23,000 permutations. For each permutation, authors randomly picked a spot; each spot could only be picked once. The gene expression and relative lifespan values were than randomly distributed over the RILs (and time points) and used for mapping. In this way, authors obtained a threshold for each of the explaining factors. For the single time points, authors used a FDR of 0.01 to adjust for multiple testing. The genome-wide threshold for this FDR is -log10 P = 3.8 for each of the three time points. For the combined models (t1 to t2 and t2 to t3), authors used a genome-wide threshold of -log10 P = 4, which resembles an FDR of 0.006, 0.001, and 0.006 for marker, age, and the interaction between marker and age, respectively. To determine the threshold for the single gene examples, authors used 1000 permutations as in the genome-wide threshold. The difference is that they use the gene under study in all of the permutations. The P-values for the gene specific thresholds were determined at FDR = 0.05.	WBPaper00036286:Pattern_C
	Proteins that showed significantly decreased expression after 1-day-old wild type adults were exposed to cisplatin (300ug per mL) for 6 hours.	The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data.	WBPaper00065373:Cisplatin_downregulated_WT

22 Expression Patterns

• Primary Identifier: Expr4609
• Remark: Reporter gene fusion type not specified.
• Pattern: Expressed in the cytoplasm from early embryogenesis to adulthood in most, if not all, cells in C. elegans. There is no clear difference in the expression patterns of alg-1 and alg-2.

• Primary Identifier: Expr2009288
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr6117
• Remark: Also expressed in (comments from author) : unidentified cells in head and tail, some probably neural, also maybe head mesodermal cell.Mosaic population. Strain: BC12839
• Reporter Gene: [alg-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCTTGTCACCGCGTAGTCTT] 3' and primer B 5' [GTCGTTTGAGGCGACGTTAG] 3'.
• Pattern: Adult Expression: pharynx; Reproductive System; uterus; vulva other; spermatheca uterine valve; spermatheca; gonad sheath cells; body wall muscle; hypodermis; seam cells; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; Reproductive System; developing vulva; developing uterus; body wall muscle; hypodermis; seam cells; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr6118
• Remark: Also expressed in (comments from author) : Unsure if detecting hypodermis or not. Strain: BC12655
• Reporter Gene: [alg-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCTTGTCACCGCGTAGTCTT] 3' and primer B 5' [GTCGTTTGAGGCGACGTTAG] 3'.
• Pattern: Adult Expression: pharynx; Nervous System; head neurons; unidentified cells in tail ; Larval Expression: pharynx; Nervous System; head neurons; unidentified cells in tail

• Primary Identifier: Expr6116
• Remark: Strain: BC12895
• Reporter Gene: [alg-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCTTGTCACCGCGTAGTCTT] 3' and primer B 5' [GTCGTTTGAGGCGACGTTAG] 3'.
• Pattern: Adult Expression: pharynx; Reproductive System; vulval muscle; body wall muscle; seam cells; Nervous System; head neurons; tail neurons; Larval Expression: pharynx; seam cells; Nervous System; head neurons

• Primary Identifier: Expr1030054
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr16401

• Primary Identifier: Expr8653
• Remark: Picture: Fig. 1.
• Pattern: Expressed throughout the animal, initiating expression in early embryos, and acculminating in the adult with intense expression in the pharynx, seam cells, distal tip cells (DTCs), somatic gonad and vulval precursor cells (VPCs), vulva and spermatheca.
• Subcellular Localization: The GFP::ALG-1 protein is localized in the cytoplasm and can be detected highly concentrated in subcellular granules.

• Primary Identifier: Expr10010
• Pattern: ALG-1 was prominently expressed in the pharynx. Cells in the tail also displayed specific expression. Expression was seen in vulva, seam cells, ventral nerve chord and somatic gonad. The endogenous ALG-1 expression was confirmed for the pharynx and head neurons with a polyclonal antibody raised against the ALG-1 specific N-terminus region. Examination of the ALG-1 expression during larval development did not reveal differences in expression during the four larval stages and adults. During embryogenesis ALG-1 is first detected at the beginning of the morphogenetic phase.

• Primary Identifier: Expr1151594
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr9968
• Pattern: RFP::ALG-1 is expressed in DTC and sheath cells besides other somatic tissues (AVR, unpublished data).

• Primary Identifier: Expr13805
• Pattern: ALG-1 and ALG-2 were expressed in most somatic cells but exhibited some tissue specificity in the head region. Pharyngeal cells predominantly expressed GFP::ALG-1, while certain head neurons adjacent to the pharynx were enriched for RFP::ALG-2. Consistent with the Western blot results, there was a global decline in expression of GFP:: ALG-1 but not RFP::ALG-2 as the animals aged.

• Primary Identifier: Expr9967
• Pattern: By immunostaining of extruded gonads using a newly generated ALG-1-specific antibody, we observed that ALG-1 is localized to the DTC of the wild-type gonads but not in alg-1(gk214).

• Primary Identifier: Chronogram436
• Remark: Original chronogram file: chronogram.1445.xml
• Reporter Gene: [F48F7.1:gfp] transcriptional fusion.

• Primary Identifier: Chronogram422
• Remark: Original chronogram file: chronogram.1432.xml
• Reporter Gene: [F48F7.1:gfp] transcriptional fusion.

• Primary Identifier: Expr2027525
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr10994
• Subcellular Localization: The translational fusion reporter for gfp::alg-1 was diffusely expressed in the cytoplasm of most embryonic cells.

• Primary Identifier: Expr15816
• Remark: CRISPR allele name not provided
• Subcellular Localization: In wild- type animals, GFP::ALG-1 is localized broadly across the cytoplasm of the cell.

• Primary Identifier: Expr13804
• Pattern: While ALG-2 levels remained relatively constant from the fourth larval stage (L4) through day 11 of adulthood, ALG-1 levels decreased precipitously during adulthood.

• Primary Identifier: Chronogram1490
• Remark: Original chronogram file: chronogram.365.xml
• Reporter Gene: [F48F7.1:gfp] transcriptional fusion.

• Primary Identifier: Expr14720
• Pattern: HA::ALG-1 was abundant throughout development, consistent with a central role for ALG-1 in the miRNA pathway.

• Primary Identifier: Expr1013052
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

26 GO Annotation

16 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00000105
• Start: 13949110
• End: 13956261
• Strand: 1

26 Ontology Annotations

12 Regulates Expr Cluster

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Genes up regulated in alg-1(gk214) comparing to in N2.	Differential expression was assessed using an empirical Bayes statistics using the eBayes function.	WBPaper00040823:alg-1(gk214)_upregulated
	Transcripts that showed significantly increased expression in alg-1(gk214), comparing to in N2.	DESeq2, Fold change > 1.5.	WBPaper00051404:alg-1(gk214)_upregulated
	Transcripts that showed significantly decreased expression in alg-1(gk214), comparing to in N2.	DESeq2, Fold change > 1.5.	WBPaper00051404:alg-1(gk214)_downregulated
	Genes upregulated by alg-1(-).	t-statistic difference of > 2.5 with p < 0.01.	WBPaper00035588:alg-1(-)_upregulated
	Transcripts that showed significantly increased expression in alg-1(gk204) comparing to in N2 at 5-days post L4 adult hermaphrodites.	DESeq, fold change > 2, adjusted p-value < 0.05.	WBPaper00054758:alg-1(gk204)_upregulated
	Genes down regulated in alg-1(gk214) comparing to in N2.	Differential expression was assessed using an empirical Bayes statistics using the eBayes function.	WBPaper00040823:alg-1(gk214)_downregulated
	Transcripts that showed significantly decreased expression in alg-1(gk204) comparing to in N2 at 5-days post L4 adult hermaphrodites.	DESeq, fold change > 2, adjusted p-value < 0.05.	WBPaper00054758:alg-1(gk204)_downregulated
	Genes with expression level up in alg-1 mutant background.	Sets of probesets with up- or down-regulated expression in the mutants relative to WT were determined via t test (two-tailed, homoscedastic) with a P value cutoff of 0.01, requiring in addition an average expression difference of 1.5 or greater on the natural scale.	WBPaper00032425:up_in_alg-1
	Genes with expression level down in alg-1 mutant background.	Sets of probesets with up- or down-regulated expression in the mutants relative to WT were determined via t test (two-tailed, homoscedastic) with a P value cutoff of 0.01, requiring in addition an average expression difference of 1.5 or greater on the natural scale.	WBPaper00032425:down_in_alg-1
	MicroRNAs that showed significantly decreased expression in alg-1(gk214), comparing to in N2.	DESeq2, Fold change > 1.5.	WBPaper00051404:alg-1(gk214)_downregulated_miRNA
	MicroRNAs that showed significantly increased expression in alg-1(gk214), comparing to in N2.	DESeq2, Fold change > 1.5.	WBPaper00051404:alg-1(gk214)_upregulated_miRNA
	Proteins identified by immunoprecipitation with GFP-ALG-1 using anit-GFP antibody, SDS-PAGE and Mass Spectrometry.	N.A.	WBPaper00034755:ALG-1_interacting

1 Sequence

• Length: 7152

1 Sequence Ontology Term