WormMine: ExpressionPattern Expr6117

• Pattern: Adult Expression: pharynx; Reproductive System; uterus; vulva other; spermatheca uterine valve; spermatheca; gonad sheath cells; body wall muscle; hypodermis; seam cells; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; Reproductive System; developing vulva; developing uterus; body wall muscle; hypodermis; seam cells; unidentified cells in head; unidentified cells in tail
• Primary Identifier: Expr6117
• Remark: Also expressed in (comments from author) : unidentified cells in head and tail, some probably neural, also maybe head mesodermal cell.Mosaic population. Strain: BC12839
• Reporter Gene: [alg-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCTTGTCACCGCGTAGTCTT] 3' and primer B 5' [GTCGTTTGAGGCGACGTTAG] 3'.

12 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
A valve tissue that connects the spermatheca and the uterus of a hermaphrodite gonad.	spermathecal-uterine junction	sp-ut valve	WBbt:0006756
female genital.	vulva		WBbt:0006748
an accordion-like tube that contains sperm and is the site of oocyte fertilization.	spermatheca		WBbt:0005319
Epidermal layer.	hypodermis	epidermis	WBbt:0005733
Longitudinal bands of muscle cells surrounding animal body, with one band running in each quadrant of the body, regulated contraction and relaxation of these muscles cause locomotion.	body wall musculature	body muscle	WBbt:0005813
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine.	pharynx	esophagus	WBbt:0003681
The organ in which the eggs are developed and protected until laid.	uterus		WBbt:0006760
a group of hypodermal cells that lie along the apical midline of the hypodermis, at the extreme left and right sides between nose and tail	seam cell	lateral hypodermis	WBbt:0005753
posterior region, from rectum to the end	tail		WBbt:0005741
five pairs of thin gonadal sheath cells form a single layer covering the germ line component of each arm, each pair occupying a stereotyped position along the gonad proximal-distal axis.	gonadal sheath cell		WBbt:0005828
anterior-most body region containing the pharynx.	head		WBbt:0005739
	reproductive system		WBbt:0005747

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00000105	alg-1	F48F7.1	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023