WormMine: Gene WBGene00000846

• WormBase Gene ID: WBGene00000846
• Gene Name: cup-5
• Sequence Name: R13A5.1
• Brief Description: The cup-5 gene encodes an ortholog of the human mucolipin 1 gene; cup-5 is required for viability, endo-lysosomal transport and the normal degradation of lysosomes; cup-5 mutants also show increased cell death, which might be a secondary consequence of lysosomal dysfunction; the inactivation of mrp-4 which is a ABCC transporter rescues most of the defects in cup-5 mutants, suggesting that the accumulation of ABC transporters in the absence of cup-5, may contribute to the lysosomal defects; cup-5 localizes to lysosomes.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable NAADP-sensitive calcium-release channel activity and phosphatidylinositol-3,5-bisphosphate binding activity. Involved in several processes, including cuticle development involved in collagen and cuticulin-based cuticle molting cycle; determination of adult lifespan; and lysosomal lumen acidification. Located in endolysosome and lysosomal membrane. Expressed in coelomocyte; head; intestinal cell; and neurons. Used to study mucolipidosis type IV. Human ortholog(s) of this gene implicated in glycoproteinosis and mucolipidosis type IV. Is an ortholog of human MCOLN1 (mucolipin TRP cation channel 1); MCOLN2 (mucolipin TRP cation channel 2); and MCOLN3 (mucolipin TRP cation channel 3).
• Biotype: SO:0001217
• Genetic Position: III :-0.663506 ±0.001899
• Length (nt): 7401

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00000846

Genomics

6 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:R13A5.1c.1	R13A5.1c.1	2215	III: 7584181-7591573
Transcript:R13A5.1a.2	R13A5.1a.2	2268	III: 7584341-7591574
Transcript:R13A5.1d.1	R13A5.1d.1	2248	III: 7584683-7591575
Transcript:R13A5.1e.1	R13A5.1e.1	2266	III: 7584683-7591581
Transcript:R13A5.1b.1	R13A5.1b.1	2586	III: 7584688-7591573
Transcript:R13A5.1a.1	R13A5.1a.1	2241	III: 7584689-7591570

Other

5 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:R13A5.1b	R13A5.1b	1935	III: 7584689-7585141
CDS:R13A5.1e	R13A5.1e	2007	III: 7584689-7585141
CDS:R13A5.1a	R13A5.1a	1824	III: 7584689-7585141
CDS:R13A5.1c	R13A5.1c	1890	III: 7584181-7584246
CDS:R13A5.1d	R13A5.1d	1995	III: 7584689-7585141

17 RNAi Result

• WBRNAi00051884
• WBRNAi00051888
• WBRNAi00017815
• WBRNAi00005545
• WBRNAi00005954
• WBRNAi00034912
• WBRNAi00065613
• WBRNAi00070919
• WBRNAi00061869
• WBRNAi00082019
• WBRNAi00082021
• WBRNAi00082020
• WBRNAi00086165
• WBRNAi00082022
• WBRNAi00079362
• WBRNAi00079361
• WBRNAi00075971

115 Allele

• gk964518
• gk963887
• WBVar01265616
• gk399294
• WBVar01397008
• WBVar02120684
• WBVar01265617
• otn16289
• WBVar02123058
• WBVar01446775
• WBVar02121593
• WBVar02124474
• WBVar02124350
• WBVar02122239
• gk639794
• gk843885
• gk408091
• WBVar02121413
• WBVar01903886
• otn448
• otn449
• WBVar01837908
• otn447
• WBVar00099695
• WBVar00060845
• WBVar02123995
• WBVar00060850
• WBVar00060855
• otn19662
• otn19663

1 Chromosome

• WormBase ID: III
• Organism: Caenorhabditis elegans
• Length (nt): 13783801

1 Chromosome Location

• Feature . Primary Identifier: WBGene00000846
• Start: 7584181
• End: 7591581
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

128 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_SM
Bacteria diet: Sphingomonas aquatilis Yellow. Fed for 30 generations.	Transcripts that showed significantly decreased expression after fed by bacteria Sphingomonas aquatilis (Yellow) for 30 generations comparing to animals fed by E. coli OP50.	DESeq2 fold change > 2, p-value < 0.01.	WBPaper00061007:S.aquatilis_downregulated
Transgeneration hypoxia treatment.	Transcripts that are significantly upregulated in F1 animals after P0 parents were exposed to 0.1% oxygen for 16 hours at L4 larva stage.	For calling the significant differentially expressed genes (DEGs),the false discovery rate (FDR) after multiple testing correction was set as 0.05 and analyzed in edgeR.	WBPaper00064871:hypoxia_upregulated_F1
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
25C vs. 20C	Transcripts that showed significantly increased expression in 1-day post L4 adult hermaphrodite N2 grown at 25C, comparing to in N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:25C_vs_20C_upregulated
	Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite N2 grown at 20C, comparing to in 1-day post L4 adult hermaphrodite N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:Day10_vs_Day1_upregulated
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
	Transcripts that showed significantly decreased expression in tetraploid N2 comparing to diploid N2 animals at L4 larva stage.	DESeq2 R package (1.20.0), fold change > 2, and FDR < 0.05.	WBPaper00066110:tetraploid_vs_diploid_downregulated
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:excretory-cell_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:GABAergic-motor-neurons_L2-larva_expressed
	Transcripts that showed significantly altered expression at URX, AQR, and PQR neurons in camt-1(ok515) animals comparing to in wild type AX1888-1 strain.	RNA-seq data were mapped using PRAGUI - a Python 3-based pipeline for RNA-seq data analysis.	WBPaper00061902:camt-1(ok515)_regulated_URX-AQR-PQR
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:hypodermis_L3-L4-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:intestine_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:PVD-OLL-neurons_L3-L4-larva_expressed
Bacteria: B.thuringiensis	Transcripts in elt-2(RNAi) animals that were significantly differentially expressed at least for one time point and one pathogenic strain Bt247 and Bt679 compared to the non pathogenic strain Bt407.	Cuffdiff	WBPaper00060358:B.thuringiensis_pathogen_regulated_elt-2(RNAi)
	Transcripts that showed significantly decreased expression in nhl-2(ok818) comparing to in N2 at 25C.	EdgeR, FDR < 0.05, fold change < 0.5.	WBPaper00055971:nhl-2(ok818)_25C_upregulated
	Transcripts that showed decreased expression in hlh-11(ko1) knockout strain comparing to in wild type background.	DESeq2, FDR < 0.05	WBPaper00060683:hlh-11(ko1)_downregulated
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours.	Transcripts that showed significantly decreased expression in hpx-2(dg047) after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50.	Cuffcompare and Cuffdiff	WBPaper00056090:E.faecalis_downregulated_hpx-2(dg047)
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:coelomocytes_L1-larva_expressed

12 Expression Patterns

• Primary Identifier: Expr6520
• Remark: Strain: BC10182
• Reporter Gene: [cup-5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCTTGGCTTCTTCGATTGC] 3' and primer B 5' [CGGCGAGAGATCTGAAATC] 3'.
• Pattern: Adult Expression: pharynx; anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; unidentified cells in head; Larval Expression: pharynx; intestine; anal depressor muscle; body wall muscle; hypodermis; unidentified cells in head

• Primary Identifier: Expr1030525
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr7931
• Remark: Picture: Figure 2. Reporter gene fusion type not specified.
• Pattern: Expressed in ASE neurons and more than 10 other neurons. Also expressed in other non-neuronal cells.

• Primary Identifier: Expr9070
• Remark: Picture: Fig 2, Fig S2.
• Subcellular Localization: mCherry::CUP-5 fully colocalizes with LMP-1::GFP. Similar colocalization between GFP::CUP-5 and LMP-1::TagRFP(S158T) was observed. Note that in addition to lysosomes, LMP-1 also localizes to, or close to, the plasma membrane of developing intestinal cells. Consistent with the lysosomal localization of CUP-5, there was no colocalization between mCherry::CUP-5 and YP170::GFP at steady state. Authors did not detect any colocalization between GFP::CUP-5 and any gut granule markers.

• Primary Identifier: Expr888
• Pattern: CUP-5 is expressed in coelomocytes. It is localized to cytoplasmic vesicles and plasma membrane-proximal structures in neurons.
• Subcellular Localization: cytoplasmic vesicles and plasma membrane-proximal structures

• Primary Identifier: Expr14897
• Pattern: cup-5 is expressed in body wall musculature.

• Primary Identifier: Expr2010597
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1155541
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2028837
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr2919
• Remark: Type: BSA-Rhod uptake in coelomocytes expressing a rescuing GFP::CUP-5 fusion protein.
• Subcellular Localization: After 15 min of uptake, most of the BSA-Rhod is in compartments that mostly lacked GFP::CUP-5. These late endosomes are the ones that are normally labeled with RME-8::GFP. However, GFP::CUP-5 colocalized with 30% (n=30) of the BSA-Rhod budding from these compartments; indeed, GFP::CUP-5 localized to the limiting membrane of these nascent lysosomes. Almost all of the internalized BSA-Rhod colocalized with the GFP::CUP-5 on mature lysosomes 60 min (90%, n=100) or 24 h (100%; n=100) after the start of the uptake assay. These results indicate that CUP-5 localizes to nascent and mature lysosomes. In agreement with the BSA-Rhod time courses in both RME-8::GFP and GFP::CUP-5 expressing coelomocytes, most of the RME-8 and CUP-5 proteins localize to different compartments. However, small discrete domains of CUP-5 localization on RME-8-labeled compartments were consistently observed. These results indicate that CUP-5 is found on subdomains of the late endosomes.

• Primary Identifier: Chronogram2063
• Remark: Original chronogram file: chronogram.970.xml
• Reporter Gene: [R13A5.1:gfp] transcriptional fusion.

• Primary Identifier: Expr1025846
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

32 GO Annotation

12 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00000846
• Start: 7584181
• End: 7591581
• Strand: 1

32 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 7401

1 Sequence Ontology Term