WormMine: Gene WBGene00009958

• WormBase Gene ID: WBGene00009958
• Gene Name: madd-4
• Sequence Name: F53B6.2
• Brief Description: madd-4 is involved in dorsal/ventral axon guidance and synapse organization; madd-4 exhibits receptor binding activity; madd-4 is expressed in the nervous system and the blast cell; madd-4 is localized to the extracellular region.
• Organism: Caenorhabditis elegans
• Automated Description: Enables signaling receptor binding activity. Involved in dorsal/ventral axon guidance and synapse organization. Located in extracellular space. Expressed in blast cell; coelomocyte; neurons; and somatic nervous system. Is an ortholog of human ADAMTS12 (ADAM metallopeptidase with thrombospondin type 1 motif 12); ADAMTSL1 (ADAMTS like 1); and ADAMTSL3 (ADAMTS like 3).
• Biotype: SO:0001217
• Genetic Position: I :3.3264±
• Length (nt): 11260

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00009958

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F53B6.2a.1	F53B6.2a.1	3351	I: 8931033-8942287
Transcript:F53B6.2b.1	F53B6.2b.1	2360	I: 8931037-8937651
Transcript:F53B6.2c.1	F53B6.2c.1	3341	I: 8931042-8942292

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F53B6.2a	F53B6.2a	3138	I: 8931163-8931232
CDS:F53B6.2b	F53B6.2b	2136	I: 8931163-8931232
CDS:F53B6.2c	F53B6.2c	3132	I: 8931163-8931232

5 RNAi Result

• WBRNAi00001160
• WBRNAi00001823
• WBRNAi00048088
• WBRNAi00003744
• WBRNAi00032675

111 Allele

• gk962858
• gk962706
• gk963902
• gk963849
• gk964316
• h7540
• h4427
• gk964252
• WBVar01694836
• gk963861
• otn17542
• WBVar01846496
• ok2854
• ok2862
• WBVar00538202
• WBVar01910007
• WBVar00155438
• WBVar00155441
• WBVar00155442
• WBVar00155439
• WBVar00155440
• WBVar00155443
• WBVar02051148
• tr158
• tr182
• tr185
• gk940113
• gk798434
• gk486182
• gk917349

1 Chromosome

• WormBase ID: I
• Organism: Caenorhabditis elegans
• Length (nt): 15072434

1 Chromosome Location

• Feature . Primary Identifier: WBGene00009958
• Start: 8931033
• End: 8942292
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

253 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	Genes significantly enriched (> 2x, FDR < 5%) in a particular cell-type versus a reference sample of all cells at the same stage.	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:A-class-motor-neurons_larva_enriched
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L1-larva_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_upregulated
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at old adults stage (214 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_aging
	Genes with expression level regulated by genotype (N2 vs CB4856) at old adults stage (214 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_regulated_aging
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Genes with expression level regulated by genotype (N2 vs CB4856) at Late reproduction stage (96 hours at 24 centigrade).	Authors permuted transcript values and used a genome-wide threshold of log10 P-value = 2, which resembles a false discovery rate (FDR) of 0.0118.	WBPaper00040858:eQTL_regulated_reproductive
	Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO.	Fold change > 2.	WBPaper00064306:Agaro-oligosaccharides_upregulated
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
Dietary restriction	Transcripts that showed significantly decreased expression after N2 animals were under dietary restriction (DR, OP50 OD = 0.1) from 3-day post L4 till 6-day post L4 adult hermaphrodite stage, comparing to under ad libtum (AL, OP50 OD = 3) condition.	Bioconductor package edgeR, p < 0.05.	WBPaper00056443:DietaryRestriction_downregulated
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Transcripts that showed significantly increased expression in alg-1(gk214), comparing to in N2.	DESeq2, Fold change > 1.5.	WBPaper00051404:alg-1(gk214)_upregulated
	Genes that showed significantly increased expression in daf-2(e1370);hel-1(gk148684) comparing to in hel-1(gk148684)	To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs.	WBPaper00047131:daf-2(e1370)_upregulated_hel-1(gk148684)-background
	Genes that showed significantly increased expression in daf-2(e1370) comparing to in N2.	To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs.	WBPaper00047131:daf-2(e1370)_upregulated_N2-background
	Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals.	Sleuth	WBPaper00051558:aging_regulated
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts depleted in purified oocyte P bodies comparing to in the whole animal.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_WholeAnimal_depleted
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:A-class-motor-neurons_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L2-larva_expressed
	Proteins that showed significantly decreased expression after 1-day-old wild type adults were exposed to cisplatin (300ug per mL) for 6 hours.	The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data.	WBPaper00065373:Cisplatin_downregulated_WT

16 Expression Patterns

• Primary Identifier: Expr6147
• Remark: Also expressed in (comments from author) : No comments. Strain: BC14990
• Reporter Gene: [F53B6.2a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATAATGTTTTCCGGTCCCTTT] 3' and primer B 5' [TGAACACTTGATTTTCATTCATTT] 3'.
• Pattern: Adult Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; Larval Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons

• Primary Identifier: Expr1151898
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr10600
• Pattern: F53B6.2a showed expression in the D-type GABAergic neurons as well as other neurons.

• Primary Identifier: Expr9680
• Pattern: Animals transgenic for a chromosomally integrated array of either madd-4Bp::YFP or madd-4Bp::RFP (called trIs79 and trIs80, respectively) expressed fluorescent protein in all commissural motor neurons and in no other cell types within the body (as opposed to the head). Through a mosaic analysis of animals harboring an extrachromosomal array of madd-4Bp::YFP, we found that the madd-4B promoter also drives expression in the head neurons RIA, RIC, lateral IL1s, lateral IL2s, OLLs, RMEs, and SABs. YFP may also be expressed in AVH, AVKL, and ASG, and AIZ. We also observed madd-4B-driven YFP expression during embryogenesis in the blast cells and corresponding terminally differentiated ventral cord motor neurons and head neurons. MADD-4B::YFP (trIs57) is localized to both the ventral and dorsal nerve cords.

• Primary Identifier: Expr16447
• Pattern: A MADD-4B-GFP fluorescent signalwas evident in both the nerve cords and coelomocytes.

• Primary Identifier: Expr11846
• Pattern: At the L1 larval stage, MADD-4B-GFP is localized at the nerve ring and at both the ventral and dorsal cords.

• Primary Identifier: Expr15845
• Pattern: MADD-4B−GFP was colocalized with both GABAergic and cholinergic neurons expressing mCherry at 10 or 16 hph of L1 stage animals, suggesting MADD-4B is persistently expressed in both cholinergic and GABAergic motor neurons of the whole L1 stage. Furthermore, in wild type animals, MADD-4B−GFP is increasingly while MADD-4L−GFP is decreasingly expressed from 10 to 16 php.

• Primary Identifier: Expr15846
• Pattern: Surprisingly, MADD-4L−GFP was colocalized not only with cholinergic neurons expressing mCherry, which is consistent with previous observation,23,24 but also with GABAergic neurons expressing mCherry at 10 or 16 hph of L1 stage animals, indicating that MADD-4L−GFP is also expressed in both cholinergic and GABAergic DD motor neurons in L1 stage of C. elegans. Furthermore, in wild type animals, MADD-4B−GFP is increasingly while MADD-4L−GFP is decreasingly expressed from 10 to 16 php.

• Primary Identifier: Expr9679
• Reporter Gene: [madd-4Ap::RFP] transcriptional fusion. The madd-4A reporter pPR681(madd-4Ap::RFP) consists of 3.2 kb of sequence upstream of the MADD-4A initiator methionine that drives the expression of red fluorescent protein (RFP).
• Pattern: Animals transgenic for madd-4Ap::RFP express RFP in the commissural GABAergic and cholinergic motor neurons. RFP expression is weak in hatchlings and increases dramatically in only the cholinergic commissural motor neurons during the second larval stage, which is coincident with the period of larval muscle arm extension (Dixon and Roy, 2005). This pattern of commissural motor neuron-specific expression persists into adulthood and no other cells or stages express RFP from the madd-4A promoter.

• Primary Identifier: Expr9681
• Reporter Gene: [madd-4::RFP] translational fusion. We made a bicistronic madd-4 reporter containing an RFP cassette that is inserted immediately 3' of the madd-4 stop codon within a fosmid harboring madd-4.
• Pattern: madd-4 reporter expresses RFP faintly in neurons of the ventral cord and the head.
• Subcellular Localization: MADD-4 is secreted and diffuses to attract muscle arms.

• Primary Identifier: Expr1034340
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr2013335
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr11845
• Pattern: At the L1 larval stage, MADD-4L-GFP is mainly localized at the nerve ring and at the dorsal cord. MADD-4L refers to long isoforms (which globally refers to MADD-4A andMADD-4C).

• Primary Identifier: Expr1014202
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2031567
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Chronogram1166
• Remark: Original chronogram file: chronogram.2288.xml
• Reporter Gene: [F53B6.2:gfp] transcriptional fusion.

13 GO Annotation

1 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00009958
• Start: 8931033
• End: 8942292
• Strand: -1

13 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 11260

1 Sequence Ontology Term