WormMine: Gene WBGene00020930

• WormBase Gene ID: WBGene00020930
• Gene Name: hlh-30
• Sequence Name: W02C12.3
• Brief Description: hlh-30 encodes a predicted basic helix-loop-helix (bHLH) transcription factor, one of 42 such genes in the C. elegans genome, it is spliced to give 18 different transcripts; it is orthologous to human microphthalmia-associated transcription factor (HGNC:MITF); loss of hlh-30 activity via RNAi results in reduced fat storage; HLH-30 demonstrates sequence-specific DNA binding for the E box sequence CACGTG and likely binds DNA as a homodimer; expression profiles of hlh-30 mutants indicate that, like its human ortholog, HLH-30 regulates expression of genes involved in metabolism; at least one of the bHLH protein isoforms appears to be important for an infection-specific immune response to M. nematophilum, though the overall induction of this gene following infection was not appreciable (1.3-fold).
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Involved in several processes, including defense response to bacterium; determination of adult lifespan; and positive regulation of metabolic process. Acts upstream of or within positive regulation of plasma membrane repair and positive regulation of xenophagy. Located in cytoplasm and nucleus. Expressed in several structures, including nerve ring; rectal valve cell; somatic cell; spermatheca; and vulva. Human ortholog(s) of this gene implicated in several diseases, including Tietz syndrome; Tietze's syndrome; and Waardenburg syndrome type 2A. Is an ortholog of human TFE3 (transcription factor binding to IGHM enhancer 3) and TFEC (transcription factor EC).
• Biotype: SO:0001217
• Genetic Position: IV :-1.01381 ±0.019046
• Length (nt): 20159

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00020930

Genomics

13 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:W02C12.3d.2	W02C12.3d.2	2555	IV: 4014793-4034951
Transcript:W02C12.3f.1	W02C12.3f.1	2449	IV: 4014795-4019044
Transcript:W02C12.3d.1	W02C12.3d.1	2359	IV: 4014795-4027063
Transcript:W02C12.3a.2	W02C12.3a.2	2514	IV: 4014800-4019039
Transcript:W02C12.3a.1	W02C12.3a.1	2517	IV: 4014800-4019042
Transcript:W02C12.3g.1	W02C12.3g.1	2583	IV: 4014800-4019043
Transcript:W02C12.3c.1	W02C12.3c.1	2575	IV: 4014800-4028127
Transcript:W02C12.3b.1	W02C12.3b.1	2499	IV: 4014801-4028127
Transcript:W02C12.3h.2	W02C12.3h.2	2138	IV: 4014810-4018407
Transcript:W02C12.3e.1	W02C12.3e.1	2224	IV: 4014855-4027063
Transcript:W02C12.3h.1	W02C12.3h.1	1113	IV: 4015759-4018331
Transcript:W02C12.3i.1	W02C12.3i.1	1422	IV: 4015759-4034784
Transcript:W02C12.3j.1	W02C12.3j.1	1347	IV: 4015759-4034784

Other

10 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:W02C12.3a	W02C12.3a	1497	IV: 4015759-4015929
CDS:W02C12.3b	W02C12.3b	1500	IV: 4015759-4015929
CDS:W02C12.3c	W02C12.3c	1575	IV: 4015759-4015929
CDS:W02C12.3f	W02C12.3f	1422	IV: 4015759-4015929
CDS:W02C12.3i	W02C12.3i	1422	IV: 4015759-4015929
CDS:W02C12.3j	W02C12.3j	1347	IV: 4015759-4015929
CDS:W02C12.3g	W02C12.3g	1314	IV: 4016569-4016784
CDS:W02C12.3d	W02C12.3d	1395	IV: 4015759-4015929
CDS:W02C12.3e	W02C12.3e	1320	IV: 4015759-4015929
CDS:W02C12.3h	W02C12.3h	1086	IV: 4015759-4015929

28 RNAi Result

• WBRNAi00107856
• WBRNAi00107857
• WBRNAi00054582
• WBRNAi00064546
• WBRNAi00014361
• WBRNAi00014362
• WBRNAi00019502
• WBRNAi00036182
• WBRNAi00113228
• WBRNAi00112998
• WBRNAi00068687
• WBRNAi00068688
• WBRNAi00068689
• WBRNAi00068690
• WBRNAi00069061
• WBRNAi00069062
• WBRNAi00092586
• WBRNAi00092722
• WBRNAi00092723
• WBRNAi00023334
• WBRNAi00023847
• WBRNAi00024135
• WBRNAi00024199
• WBRNAi00092007
• WBRNAi00078258
• WBRNAi00092720
• WBRNAi00092721
• WBRNAi00099119

398 Allele

• gk963722
• gk963908
• otn11266
• WBVar02020477
• WBVar02020476
• WBVar02020475
• WBVar02020474
• WBVar02020473
• WBVar02020478
• WBVar01630558
• tm11220
• gk830278
• WBVar00188266
• WBVar00188267
• WBVar00188268
• WBVar00188269
• WBVar00188270
• WBVar00188271
• WBVar00188272
• WBVar00188273
• WBVar00188274
• WBVar00188275
• WBVar00188276
• WBVar00188277
• WBVar00188278
• WBVar00188279
• WBVar00188280
• WBVar00188281
• WBVar00188282
• WBVar00188283

1 Chromosome

• WormBase ID: IV
• Organism: Caenorhabditis elegans
• Length (nt): 17493829

1 Chromosome Location

• Feature . Primary Identifier: WBGene00020930
• Start: 4014793
• End: 4034951
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_4014236..4014792
• Length (nt): 557
• Chromosome Location: IV: 4014236-4014792
• Organism: Caenorhabditis elegans

171 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Genes with expression altered >= 3-fold in dpy-10(e128) mutants.	Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)).	WBPaper00035873:dpy-10_regulated
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
Bacteria: E.faecalis strain OG1RF	Transcripts that showed significantly increased expression after infection by E. faecalis OG1RF.	Ballgown was used to calculate differential expression of genes using FPKM data and to generate tables with fold change and P values. Genes were shortlisted with a cutoff of 2-fold change and P values of less than 0.05.	WBPaper00059754:E.faecalis_OG1RF_upregulated
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_developing
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_regulated_developing
	Transcripts expressed in vulva.	FPKM >= 1.	WBPaper00064122:vulva_transcriptome
	Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO.	Fold change > 2.	WBPaper00064306:Agaro-oligosaccharides_upregulated
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure.	Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2).	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:S.aureus-4h_upregulated_N2
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
	Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in N2.	Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1.	WBPaper00053810:daf-2(e1370)_upregulated
	Transcripts that showed significantly increased expression in nuo-6(qm200) comparing to in N2.	Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1.	WBPaper00053810:nuo-6(qm200)_upregulated
Bacteria infection: Staphylococcus aureus	mRNAs that showed increased expression 8 hours after N2 animals were infected by S. aureus.	DESeq, p <= 0.05	WBPaper00045314:S.aureus-induced_N2
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
	Transcripts that showed significantly increased expression in srbc-48(ac23);kyIs262;fer-1(b232ts) comparing to in kyIs262;fer-1(b232ts), 24h after infection with P.aeruginosa.	DESeq2, FDR <0.05, fold change > 2.	WBPaper00059664:srbc-48(ac23)_upregulated

18 Expression Patterns

• Primary Identifier: Expr6821
• Remark: Strain: BC10509
• Reporter Gene: [W02C12.3a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCATATCAAAAGTGAGTTACCGC] 3' and primer B 5' [TCGTCATCGGCGATTTTT] 3'.
• Pattern: Adult Expression: Reproductive System; vulval muscle; Nervous System; ventral nerve cord; head neurons; tail neurons; Larval Expression: Nervous System; head neurons; tail neurons; unidentified cells in head

• Primary Identifier: Expr6822
• Remark: Strain: BC11288
• Reporter Gene: [W02C12.3b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCGCTTTAGGGGCTAATAAAA] 3' and primer B 5' [GCGGATGATGAATGCTCTTA] 3'.
• Pattern: Adult Expression: intestine; anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; Nervous System; head neurons; Larval Expression: intestine; body wall muscle; Nervous System; head neurons; unidentified cells

• Primary Identifier: Expr6823
• Remark: Strain: BC12701
• Reporter Gene: [W02C12.3d::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGGAACACCACTAGGGAGGTA] 3' and primer B 5' [CTAAATTTCGGTCGTTGATGC] 3'.
• Pattern: Adult Expression: intestine; Reproductive System; vulval muscle; body wall muscle; unidentified cells; Larval Expression: pharynx; body wall muscle; unidentified cells

• Primary Identifier: Expr6824
• Remark: Strain: BC12849
• Reporter Gene: [W02C12.3d::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGGAACACCACTAGGGAGGTA] 3' and primer B 5' [CTAAATTTCGGTCGTTGATGC] 3'.
• Pattern: Adult Expression: Reproductive System; Nervous System; tail neurons; unidentified cells in head; unidentified cells in body ; Larval Expression: Nervous System; tail neurons

• Primary Identifier: Expr11824
• Pattern: In uninfected animals, HLH- 30::GFP protein was expressed throughout development. In L4 larvae and young adults expression was highest in the intestine, rectal epithelial cells, vulval epithelial cells, spermathecae, and pharynx and absent from the gonads.
• Subcellular Localization: The GFP signal was equally distributed between nucleus and cytoplasm of expressing cells, suggesting that HLH-30 may reside in both compartments in uninfected animals.

• Primary Identifier: Expr9775
• Pattern: The fluorescence appeared diffuse suggesting that the GFP is distributed throughout the cytoplasm of the cells in which it is expressed. The GFP was very broadly expressed but appeared specifically absent from the pharynx and germline in adults. The strongest fluorescence was in the intestinal/rectal valve and the nerve ring, and was brightest and more extensive in the L4 and adult. Another strain transgenic for this reporter gene fusion, UL3664, was generated and showed the same expression pattern, but transgene transmission was very low and therefore the strain was not retained.

• Primary Identifier: Expr15847
• Pattern: HLH-30::GFP was observed throughout the nervous system and primarily localized to cytoplasm in all genetic backgrounds tested.

• Primary Identifier: Expr9785
• Pattern: Extremely strong and widespread GFP expression was observed in many, possibly all, tissue types with the exception of the germline.

• Primary Identifier: Expr9774
• Pattern: The GFP expression pattern was weaker but very similar to that observed in UL3220, generated in a similar fashion but with gfp inserted after the hlh-30 stop codon. GFP expression was only seen from late embryogenesis rather than early embryogenesis. Nevertheless, GFP expression was very broad, with the degree of nuclear localization varying between individuals. The uneven distribution within the nucleus, seen occasionally, may reflect aggregation of GFP.

• Primary Identifier: Expr9776
• Pattern: No GFP expression was seen in two independent strains confirmed as transgenic for fUL#HC67 by PCR.

• Primary Identifier: Expr9739
• Pattern: Very broad GFP expression was observed from early embryogenesis through to mature adult in many, possibly all, tissues types with the exception of the germline. The degree of nuclear localisation varies with tissue type and between individuals. In adults, nuclear expression has a 'speckled' appearance, possibly reflecting aggregation of GFP.

• Primary Identifier: Chronogram779
• Remark: Original chronogram file: chronogram.1818.xml
• Reporter Gene: [W02C12.3:gfp] transcriptional fusion.

• Primary Identifier: Chronogram988
• Remark: Original chronogram file: chronogram.2042.xml
• Reporter Gene: [W02C12.3:gfp] transcriptional fusion.

• Primary Identifier: Expr2012505
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1158126
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr1039117
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr1015152
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2030744
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

26 GO Annotation

20 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00020930
• Start: 4014793
• End: 4034951
• Strand: -1

26 Ontology Annotations

6 Regulates Expr Cluster

Regulated By Treatment	Description	Algorithm	Primary Identifier
Bacteria infection: Staphylococcus aureus	mRNAs that showed increased expression 8 hours after hlh-30(tm1978) animals were infected by S. aureus.	DESeq, p <= 0.05	WBPaper00045314:S.aureus-induced_hlh-30(tm1978)
	Genes that showed differential expression after fed with Cry5B in N2 but not in hlh-30(tm1978).	The genes with a P value of less than 0.05 were selected as differentially expressed genes. Statistical analysis between 2 values was compared with a paired t test, and among 3 or more values of one independent variable was done with matched one-way ANOVA with the Tukey post-hoc test and more than 2 independent variables by 2-way ANOVA with the Bonferroni post test. All data analysis was performed using SPSS, ver 13.0. Statistical significance was set at P < 0.05.	WBPaper00050468:hlh-30-dependent_Cry5B_regulated
	Genes with decreased expression in hlh-30(tm1978) mutant.	Authors considered as differentially expressed those genes whose probe sets had a P < 0.01 and log2(fold-change) >= 0.7.	WBPaper00034761:hlh-30_downregulated
	Transcripts that showed significantly decreased expression in neuron specific hlh-30(RNAi); glp-1(e2141); TU3401 animals, comparing to in glp-1(e2141); TU3401 animals fed with control vector.	Fold change > 2, FDR < 0.01.	WBPaper00065993:hlh-30(RNAi)-neuron_downregulated
	Genes with increased expression in hlh-30(tm1978) mutant.	Authors considered as differentially expressed those genes whose probe sets had a P < 0.01 and log2(fold-change) >= 0.7.	WBPaper00034761:hlh-30_upregulated
	Transcripts that showed significantly increased expression in neuron specific hlh-30(RNAi); glp-1(e2141); TU3401 animals, comparing to in glp-1(e2141); TU3401 animals fed with control vector.	Fold change > 2, FDR < 0.01.	WBPaper00065993:hlh-30(RNAi)-neuron_upregulated

1 Sequence

• Length: 20159

1 Sequence Ontology Term