WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: pharynx; pharyngeal-intestinal valve; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; tail neurons; Larval Expression: pharynx; pharyngeal-intestinal valve; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; tail neurons; Primary Identifier  Expr6758
Remark  Also expressed in (comments from author) : Mosaic population. Strain: BC14012 Reporter Gene  [T24D11.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCGAGTTCTACTTTTTGGCGA] 3' and primer B 5' [AATGACAAAGAACAACAATCGGT] 3'.

10 Anatomy Terms

Definition Name Synonym Primary Identifier
neuron with cell body associated with the ventral nerve cord. ventral cord neuron ventral cord motoneuron WBbt:0005300
A group of six equivalent cells forms a tightly constructed `valve` that links the posterior bulb of the pharynx to the anterior four cells of the intestine. These six cells comprise a small epithelial channel with a cuticular lining in continuity with the pharyngeal cuticle and link the lumen of the pharynx to the large lumen of the anterior intestine. pharyngeal-intestinal valve cardia WBbt:0005767
Epidermal layer. hypodermis epidermis WBbt:0005733
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities. nervous system   WBbt:0005735
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine. pharynx esophagus WBbt:0003681
neuron with its cell body situated in the tail, posterior to rectum. tail neuron   WBbt:0006759
a group of hypodermal cells that lie along the apical midline of the hypodermis, at the extreme left and right sides between nose and tail seam cell lateral hypodermis WBbt:0005753
the most extensive region of neuropil in the animal, consists of a large toroidal bundle of processes. nerve ring circumpharyngeal nerve ring WBbt:0006749
a bundle of nerve processes that runs along the dorsal mid-line of the animal. dorsal nerve cord dorsal cord WBbt:0006750
nerve cord positioned at the lateral flanks of the animal, consists of processes of the neuron classes BDU, CAN, PVD and ALA. lateral nerve cord   WBbt:0006769

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00020770 eat-17 T24D11.1 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023