WormMine: ExpressionPattern Expr6926

• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; Reproductive System; vulva other; spermatheca; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ; Embryo Expression: hypodermis; Larval Expression: pharynx; pharyngeal-intestinal valve; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; unidentified cells in head; unidentified cells in body ;unidentified cells in tail
• Primary Identifier: Expr6926
• Remark: Strain: BC10653
• Reporter Gene: [Y32H12A.8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGTCTCTTCCCTCATTGTCG] 3' and primer B 5' [CGATGTGCTGGAAATTTGG] 3'.

14 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
neuron with cell body associated with the ventral nerve cord.	ventral cord neuron	ventral cord motoneuron	WBbt:0005300
an accordion-like tube that contains sperm and is the site of oocyte fertilization.	spermatheca		WBbt:0005319
female genital.	vulva		WBbt:0006748
A group of six equivalent cells forms a tightly constructed `valve` that links the posterior bulb of the pharynx to the anterior four cells of the intestine. These six cells comprise a small epithelial channel with a cuticular lining in continuity with the pharyngeal cuticle and link the lumen of the pharynx to the large lumen of the anterior intestine.	pharyngeal-intestinal valve	cardia	WBbt:0005767
Epidermal layer.	hypodermis	epidermis	WBbt:0005733
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine.	pharynx	esophagus	WBbt:0003681
neuron with its cell body situated in the head, excluding the pharynx.	head neuron		WBbt:0006751
Major cell type of nervous tissue, specialized for transmission of information in the form of patterns of impulses.	neuron	neurone	WBbt:0003679
the most extensive region of neuropil in the animal, consists of a large toroidal bundle of processes.	nerve ring	circumpharyngeal nerve ring	WBbt:0006749
posterior region, from rectum to the end	tail		WBbt:0005741
anterior-most body region containing the pharynx.	head		WBbt:0005739
	reproductive system		WBbt:0005747
region of the body by which tissues, cells or cell parts are classified	body region		WBbt:0005738

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00021316	Y32H12A.8	Y32H12A.8	Caenorhabditis elegans

3 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	The whole period of embryogenesis in the nematode Caenorhabditis elegans, from the formation of an egg until hatching.		embryo Ce	WBls:0000003
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023