WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Hide

Oops!

http://intermine.wormbase.org/tools/wormmine/service/ is incorrect

Expression Pattern :

Pattern  Adult Expression: excretory cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; amphids; mechanosensory neurons; pharyngeal neurons; neurons along body; tail neurons; phasmids; Larval Expression: excretory cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; amphids; mechanosensory neurons; pharyngeal neurons; neurons along body; tail neurons; phasmids; Primary Identifier  Expr6497
Remark  Also expressed in (comments from author) : No comments. Strain: BC14834 Reporter Gene  [srab-14::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGCGACCTCAGTTTTTGAG] 3' and primer B 5' [TGTTTTGTCTGAAAATTCGGG] 3'.

13 Anatomy Terms

Definition Name Synonym Primary Identifier
neuron with cell body associated with the ventral nerve cord. ventral cord neuron ventral cord motoneuron WBbt:0005300
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities. nervous system   WBbt:0005735
neuron with its cell body situated in the head, excluding the pharynx. head neuron   WBbt:0006751
neurons that sense body touch, have specialized microtubules in processes. touch receptor neuron microtubule cell WBbt:0005237
neuron with its cell body situated in the tail, posterior to rectum. tail neuron   WBbt:0006759
Major cell type of nervous tissue, specialized for transmission of information in the form of patterns of impulses. neuron neurone WBbt:0003679
neuron of the pharyngeal nervous system. pharyngeal neuron   WBbt:0005439
H-shaped cell associated with the excretory system, largest cell in C. elegans. excretory cell excretory canal cell WBbt:0005812
the most extensive region of neuropil in the animal, consists of a large toroidal bundle of processes. nerve ring circumpharyngeal nerve ring WBbt:0006749
a bundle of nerve processes that runs along the dorsal mid-line of the animal. dorsal nerve cord dorsal cord WBbt:0006750
neuron of phasmid sensillum phasmid neuron   WBbt:0006753
neuron of the amphid sensillum amphid neuron amphid sensory neuron WBbt:0005394
nerve cord positioned at the lateral flanks of the animal, consists of processes of the neuron classes BDU, CAN, PVD and ALA. lateral nerve cord   WBbt:0006769

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00019999 srab-14 R10H1.2 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023