WormMine: ExpressionPattern Expr6774

• Pattern: Adult Expression: pharynx; arcade cells; intestine; Reproductive System; vulval muscle; vulva other; hypodermis; seam cells; Nervous System; head neurons; labial sensilla; unidentified cells in head; Larval Expression: arcade cells; intestine; Reproductive System; developing vulva; hypodermis; seam cells; Nervous System; head neurons; labial sensilla; unidentified cells in head
• Primary Identifier: Expr6774
• Remark: Also expressed in (comments from author) : unidentified cells in head, possibly labial sensilla. Strain: DM12747
• Reporter Gene: [set-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTACGCTCATCAGGCAGTAGTTT] 3' and primer B 5' [CCTTCGAGTGACACCGCT] 3'.

12 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
A chain of very large cuboidal cells forming a wide central lumen in which food arrives from the posterior pharynx, is digested, and from which waste products proceed to the rectum. Intestinal rings form in groups of two and four cells surrounding the common lumen; thus the epithelium is only one cell deep at any point, with neighboring cells firmly secured to their neighbors by apical adherens junctions. These cells have very large nuclei and many large vacuoles, yolk granules, and other inclusions; the latter increase in number and electron density as the animal ages.	intestine	gut	WBbt:0005772
female genital.	vulva		WBbt:0006748
Epidermal layer.	hypodermis	epidermis	WBbt:0005733
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
muscle associated with hermaphrodite vulva.	vulval muscle		WBbt:0005821
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine.	pharynx	esophagus	WBbt:0003681
neuron with its cell body situated in the head, excluding the pharynx.	head neuron		WBbt:0006751
a group of hypodermal cells that lie along the apical midline of the hypodermis, at the extreme left and right sides between nose and tail	seam cell	lateral hypodermis	WBbt:0005753
Interfacial (hypodermal) cells which connect the hypodermal epithelium of the lips to the pharyngeal epithelium, firmly binding the inner tissue (the pharynx) to the outer bodywall (the hypodermis).	arcade cell		WBbt:0005793
anterior-most body region containing the pharynx.	head		WBbt:0005739
	reproductive system		WBbt:0005747
sensillum of inner or outer labial.	labial sensillum		WBbt:0005107

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00004781	set-1	T26A5.7	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023