WormMine: Gene WBGene00004036

• WormBase Gene ID: WBGene00004036
• Gene Name: plc-1
• Sequence Name: F31B12.1
• Brief Description: plc-1 encodes a predicted phospholipase C that affects fertility and possesses two functional domains not commonly seen in other phospholipases: a C-terminal Ras-associating domain with structural similarity to RalGDS and AF-6, and an N-terminal CDC25-like domain that possesses structural homology to guanine nucleotide exchange proteins for Ras.
• Organism: Caenorhabditis elegans
• Automated Description: Enables GTPase inhibitor activity; phosphatidylinositol phospholipase C activity; and small GTPase binding activity. Involved in several processes, including 1-phosphatidyl-1D-myo-inositol 4,5-bisphosphate catabolic process; defense response to Gram-positive bacterium; and positive regulation of protein import into nucleus. Expressed in excretory system; intestine; neurons; spermatheca; and vulva. Human ortholog(s) of this gene implicated in gastric adenocarcinoma; nephrotic syndrome type 2; and nephrotic syndrome type 3. Is an ortholog of human PLCE1 (phospholipase C epsilon 1).
• Biotype: SO:0001217
• Genetic Position: X :2.53988 ±0.004789
• Length (nt): 43794

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00004036

Genomics

12 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F31B12.1c.1	F31B12.1c.1	5901	X: 10794857-10812534
Transcript:F31B12.1a.1	F31B12.1a.1	5938	X: 10795747-10812572
Transcript:F31B12.1b.1	F31B12.1b.1	5909	X: 10796145-10812534
Transcript:F31B12.1f.1	F31B12.1f.1	5829	X: 10796447-10811705
Transcript:F31B12.1e.1	F31B12.1e.1	5637	X: 10796447-10812534
Transcript:F31B12.1d.1	F31B12.1d.1	10656	X: 10796447-10838650
Transcript:F31B12.1g.1	F31B12.1g.1	10485	X: 10796447-10838650
Transcript:F31B12.1h.1	F31B12.1h.1	10515	X: 10796447-10838650
Transcript:F31B12.1i.1	F31B12.1i.1	10635	X: 10796447-10838650
Transcript:F31B12.1j.1	F31B12.1j.1	10464	X: 10796447-10838650
Transcript:F31B12.1k.1	F31B12.1k.1	10665	X: 10796447-10838650
Transcript:F31B12.1l.1	F31B12.1l.1	10494	X: 10796447-10838650

Other

12 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F31B12.1c	F31B12.1c	5688	X: 10795070-10795207
CDS:F31B12.1b	F31B12.1b	5607	X: 10796447-10796655
CDS:F31B12.1f	F31B12.1f	5661	X: 10796447-10796655
CDS:F31B12.1d	F31B12.1d	10656	X: 10796447-10796655
CDS:F31B12.1g	F31B12.1g	10485	X: 10796447-10796655
CDS:F31B12.1h	F31B12.1h	10515	X: 10796447-10796655
CDS:F31B12.1l	F31B12.1l	10494	X: 10796447-10796655
CDS:F31B12.1a	F31B12.1a	5697	X: 10795950-10796051
CDS:F31B12.1e	F31B12.1e	5637	X: 10796447-10796655
CDS:F31B12.1i	F31B12.1i	10635	X: 10796447-10796655
CDS:F31B12.1j	F31B12.1j	10464	X: 10796447-10796655
CDS:F31B12.1k	F31B12.1k	10665	X: 10796447-10796655

25 RNAi Result

• WBRNAi00067315
• WBRNAi00067336
• WBRNAi00067380
• WBRNAi00067494
• WBRNAi00067515
• WBRNAi00067560
• WBRNAi00067586
• WBRNAi00067841
• WBRNAi00039683
• WBRNAi00045986
• WBRNAi00045987
• WBRNAi00045988
• WBRNAi00045989
• WBRNAi00085485
• WBRNAi00064747
• WBRNAi00008730
• WBRNAi00025336
• WBRNAi00014136
• WBRNAi00014137
• WBRNAi00078902
• WBRNAi00078906
• WBRNAi00063865
• WBRNAi00084145
• WBRNAi00084147
• WBRNAi00078904

621 Allele

• gk964260
• gk962707
• gk963810
• WBVar01928234
• WBVar01928235
• WBVar01928236
• WBVar01928237
• WBVar01928238
• WBVar01987666
• gk962546
• gk292717
• rx1
• rx2
• WBVar01759325
• WBVar01759327
• WBVar01759326
• WBVar01759329
• WBVar01759328
• WBVar01759330
• WBVar01759332
• WBVar01759331
• WBVar01759334
• WBVar01759333
• WBVar01759335
• WBVar02066056
• WBVar02066054
• WBVar02066055
• WBVar02066052
• WBVar02066053
• WBVar01602157

1 Chromosome

• WormBase ID: X
• Organism: Caenorhabditis elegans
• Length (nt): 17718942

1 Chromosome Location

• Feature . Primary Identifier: WBGene00004036
• Start: 10794857
• End: 10838650
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrX_10794748..10794856
• Length (nt): 109
• Chromosome Location: X: 10794748-10794856
• Organism: Caenorhabditis elegans

194 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_upregulated
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
Bacteria infection: Enterococcus faecalis	Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
	Coexpression clique No. 60, 176662_at-Y53F4B.16, on the genome-wide coexpression clique map for the nematode GPL200 platform.	All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform.	WBPaper00061527:176662_at-Y53F4B.16
	Transcripts that showed significantly increased expression in hsf-1(sy441) vs. in N2 day 1 adults without heat shock.	edgeR, fold change > 2, FDR < 0.05	WBPaper00066900:hsf-1(sy441)_upregulated
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage.	edgeR, fold change > 2, FDR < 0.05	WBPaper00060909:atfs-1(cmh15)_downregulated
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at old adults stage (214 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_aging
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_developing
	Genes with expression level regulated by genotype (N2 vs CB4856) at old adults stage (214 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_regulated_aging
	Genes with expression level regulated by genotype (N2 vs CB4856) at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_regulated_developing
	Genes with expression level regulated by genotype (N2 vs CB4856) at Late reproduction stage (96 hours at 24 centigrade).	Authors permuted transcript values and used a genome-wide threshold of log10 P-value = 2, which resembles a false discovery rate (FDR) of 0.0118.	WBPaper00040858:eQTL_regulated_reproductive
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
	Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO.	Fold change > 2.	WBPaper00064306:Agaro-oligosaccharides_upregulated
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Genes that showed significantly increased expression in daf-2(e1370) comparing to in N2.	To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs.	WBPaper00047131:daf-2(e1370)_upregulated_N2-background
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts depleted in purified oocyte P bodies comparing to in the whole animal.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_WholeAnimal_depleted
	Transcripts that showed significantly increased expression in xrep-4(lax137).	DESeq2. Genes were selected if their p value < 0.01.	WBPaper00066062:xrep-4(lax137)_upregulated

11 Expression Patterns

• Primary Identifier: Expr1031937
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr5921
• Remark: Strain: BC13488
• Reporter Gene: [plc-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAGCCTTGTTCAATTGTCCG] 3' and primer B 5' [GAGTGTCCCAGTTGATTGCAT] 3'.
• Pattern: Adult Expression: intestine - ant and post cells; Larval Expression: intestine - ant and post cells

• Primary Identifier: Expr3058
• Pattern: Expression of EGFP was observed in the spermatheca. In addition, the plc-1::egfp reporter expression was observed in the vulva, intestine, excretory cells, and neurons. The onset of expression in the spermatheca was during the early adult stage, while that in excretory cells and neurons were earlier.

• Primary Identifier: Expr11169
• Pattern: A transcriptional reporter of plc-1 was expressed in head sensory neurons AWC, AFD, ASE, ASG and BAG, as well as interneurons RIF, ventral nerve cord neurons, tail neurons and body muscles.

• Primary Identifier: Expr2011891
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr2014951
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Chronogram1263
• Remark: Original chronogram file: chronogram.2386.xml
• Reporter Gene: [F31B12.1:gfp] transcriptional fusion.

• Primary Identifier: Expr2033186
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr2030128
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1017507
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1149885
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

28 GO Annotation

4 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00004036
• Start: 10794857
• End: 10838650
• Strand: -1

28 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 43794

1 Sequence Ontology Term

• Name: gene

4 Strains

• WBStrain00030933
• WBStrain00030932
• WBStrain00051732
• WBStrain00002612

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrX_10838651..10840283
• Length (nt): 1633
• Chromosome Location: X: 10838651-10840283
• Organism: Caenorhabditis elegans