WormMine: Gene WBGene00006779

• WormBase Gene ID: WBGene00006779
• Gene Name: unc-43
• Sequence Name: K11E8.1
• Brief Description: unc-43 encodes the C. elegans ortholog of type II calcium/calmodulin-dependent protein kinase (CaMKII); unc-43 activity is required for a number of processes, including locomotion, neuronal cell fate specification and regulation of synaptic density, egg laying, defecation, and meiotic maturation; in regulating some of these processes, unc-43 acts in concert with MAPKKK and G protein signaling pathways; UNC-43 is expressed in neurons, oocytes, and gonadal sheath cells; UNC-43 can regulate the activity of the EGL-2 ether-a-go-go potassium channel with which it physically interacts.
• Organism: Caenorhabditis elegans
• Automated Description: Enables calmodulin-dependent protein kinase activity; identical protein binding activity; and transmembrane transporter binding activity. Involved in MAPK cascade; medium-term memory; and positive regulation of gene expression. Acts upstream of or within serotonin biosynthetic process. Located in axon cytoplasm. Expressed in several structures, including AWC; copulatory spicule; gonadal sheath cell; postcloacal sensillum; and somatic nervous system. Human ortholog(s) of this gene implicated in Alzheimer's disease; intellectual disability (multiple); and malignant astrocytoma. Is an ortholog of human CAMK2D (calcium/calmodulin dependent protein kinase II delta).
• Biotype: SO:0001217
• Genetic Position: IV :4.57616 ±0.00067
• Length (nt): 25964

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00006779

Genomics

25 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:K11E8.1h.2	K11E8.1h.2	2692	IV: 10324254-10340566
Transcript:K11E8.1m.1	K11E8.1m.1	1920	IV: 10324254-10331222
Transcript:K11E8.1a.1	K11E8.1a.1	1434	IV: 10324255-10331827
Transcript:K11E8.1g.2	K11E8.1g.2	2538	IV: 10324255-10340566
Transcript:K11E8.1d.2	K11E8.1d.2	2501	IV: 10324255-10348971
Transcript:K11E8.1g.1	K11E8.1g.1	2603	IV: 10324256-10348960
Transcript:K11E8.1o.1	K11E8.1o.1	1726	IV: 10324280-10331174
Transcript:K11E8.1f.2	K11E8.1f.2	2498	IV: 10324285-10340562
Transcript:K11E8.1f.1	K11E8.1f.1	2579	IV: 10324285-10348971
Transcript:K11E8.1i.1	K11E8.1i.1	4845	IV: 10324287-10340567
Transcript:K11E8.1n.1	K11E8.1n.1	1527	IV: 10324290-10329888
Transcript:K11E8.1d.1	K11E8.1d.1	2352	IV: 10324317-10340556
Transcript:K11E8.1e.2	K11E8.1e.2	2511	IV: 10324317-10340562
Transcript:K11E8.1e.1	K11E8.1e.1	2578	IV: 10324317-10348957
Transcript:K11E8.1h.1	K11E8.1h.1	2683	IV: 10324325-10348956
Transcript:K11E8.1q.1	K11E8.1q.1	312	IV: 10324996-10326346
Transcript:K11E8.1t.1	K11E8.1t.1	897	IV: 10324996-10332540
Transcript:K11E8.1p.1	K11E8.1p.1	651	IV: 10324996-10334151
Transcript:K11E8.1s.1	K11E8.1s.1	801	IV: 10324996-10336243
Transcript:K11E8.1k.1	K11E8.1k.1	1415	IV: 10324996-10340168
Transcript:K11E8.1l.1	K11E8.1l.1	1400	IV: 10324996-10340168
Transcript:K11E8.1r.1	K11E8.1r.1	2046	IV: 10324996-10350217
Transcript:K11E8.1b.3	K11E8.1b.3	568	IV: 10338698-10340322
Transcript:K11E8.1b.2	K11E8.1b.2	638	IV: 10338698-10340556
Transcript:K11E8.1b.1	K11E8.1b.1	719	IV: 10338698-10348965

Other

18 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:K11E8.1m	K11E8.1m	930	IV: 10324996-10325125
CDS:K11E8.1q	K11E8.1q	312	IV: 10324996-10325125
CDS:K11E8.1t	K11E8.1t	897	IV: 10324996-10325125
CDS:K11E8.1p	K11E8.1p	651	IV: 10324996-10325125
CDS:K11E8.1r	K11E8.1r	2046	IV: 10324996-10325125
CDS:K11E8.1k	K11E8.1k	909	IV: 10327701-10327715
CDS:K11E8.1l	K11E8.1l	909	IV: 10329181-10329195
CDS:K11E8.1a	K11E8.1a	693	IV: 10324996-10325125
CDS:K11E8.1b	K11E8.1b	414	IV: 10338698-10338776
CDS:K11E8.1d	K11E8.1d	1449	IV: 10324996-10325125
CDS:K11E8.1e	K11E8.1e	1602	IV: 10324996-10325125
CDS:K11E8.1f	K11E8.1f	1557	IV: 10324996-10325125
CDS:K11E8.1g	K11E8.1g	1563	IV: 10324996-10325125
CDS:K11E8.1h	K11E8.1h	1716	IV: 10324996-10325125
CDS:K11E8.1i	K11E8.1i	1053	IV: 10329086-10329201
CDS:K11E8.1n	K11E8.1n	648	IV: 10324996-10325125
CDS:K11E8.1o	K11E8.1o	810	IV: 10324996-10325125
CDS:K11E8.1s	K11E8.1s	801	IV: 10324996-10325125

16 RNAi Result

• WBRNAi00089723
• WBRNAi00001630
• WBRNAi00050607
• WBRNAi00080522
• WBRNAi00017017
• WBRNAi00020523
• WBRNAi00076570
• WBRNAi00108306
• WBRNAi00027909
• WBRNAi00088588
• WBRNAi00088695
• WBRNAi00089964
• WBRNAi00090124
• WBRNAi00090282
• WBRNAi00075964
• WBRNAi00114864

357 Allele

• otn10041
• gk964278
• gk964078
• gk964500
• gk962765
• otn12296
• sa200
• WBVar00245639
• sy574
• sy574B
• sy574A
• WBVar02021117
• WBVar02021118
• WBVar01549010
• gk946550
• gk946551
• gk946552
• ky398
• h11089
• n408
• cxTi10952
• e755
• e408
• e266
• otn19866
• gk452
• gk769967
• gk552154
• gk781373
• gk570523

1 Chromosome

• WormBase ID: IV
• Organism: Caenorhabditis elegans
• Length (nt): 17493829

1 Chromosome Location

• Feature . Primary Identifier: WBGene00006779
• Start: 10324254
• End: 10350217
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_10322751..10324253
• Length (nt): 1503
• Chromosome Location: IV: 10322751-10324253
• Organism: Caenorhabditis elegans

227 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Genes with expression altered >= 3-fold in dpy-10(e128) mutants.	Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)).	WBPaper00035873:dpy-10_regulated
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_upregulated
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
	Genes that were downregulated in lin-15B(n744).	For each gene in each microarray hybridization experiment, the ratio of RNA levels from the two samples was transformed into a log2 value and the mean log2 ratio was calculated. The log2 ratios were normalized by print-tip Loess normalization (Dudoit and Yang, 2002). All genes with a false discovery rate of <= 5% (q <= 0.05) (Storey and Tibshirani, 2003) and a mean fold-change ratio of >= 1.5 were selected for further analysis.	WBPaper00038168:lin-15B(n744)_downregulated
	Coexpression clique No. 203, sre-33-ZK1025.1_8337, on the genome-wide coexpression clique map for the nematode GPL200 platform.	All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform.	WBPaper00061527:sre-33-ZK1025.1_8337
	Genome-wide analysis of developmental and sex-regulated gene expression profile.	self-organizing map	cgc4489_group_18
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_developing
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_regulated_developing
	Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO.	Fold change > 2.	WBPaper00064306:Agaro-oligosaccharides_upregulated
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
	Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in control animals.	NOIseq(v2.34.0), fold change > = 1.5, Differentially expressed genes (DEGs) were defined as having a probability of differentialexpression > 95%.	WBPaper00064727:daf-2(e1370)_upregulated
	Significantly upregulated genes from clk-1(qm30) microarrays using SAM algorithm with an FDR < 0.1 from adult-only chips.	SAM algorithm with an FDR < 0.1.	WBPaper00033065:clk-1(qm30)_upregulated
	Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals.	Sleuth	WBPaper00051558:aging_regulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts depleted in purified oocyte P bodies comparing to in whole oocytes.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_oocyte_depleted

12 Expression Patterns

• Primary Identifier: Expr4978
• Remark: Picture: Figure 1B and 1C.
• Pattern: In males, CaMKII is broadly expressed in excitable cells, including the spicule protractor and retractor muscles, SPC, and postcloacal sensilla neurons.

• Primary Identifier: Expr6389
• Remark: Strain: BC11417
• Reporter Gene: [unc-43::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GACACGGCACGAAAATTAAAA] 3' and primer B 5' [GCTAATTGCTGAAGATAGTGCTGA] 3'.
• Pattern: Adult Expression: intestine - . cells; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; unidentified cells; Larval Expression: intestine; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr9640
• Pattern: UNC-43 expression was notably enriched in the TIR-1-containing puncta in the AWC axon. UNC-43 has previously been shown to be enriched in post-synaptic domains (Rongo and Kaplan 1999). These results suggest that UNC-43 resides at post-synaptic regions of AWC.

• Primary Identifier: Expr2036012
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1032851
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr3783
• Subcellular Localization: To evaluate the subcellular distribution, a z-series was generated through the gonad and processed the images with deconvolution software. Phosphorylated T284 (pT284) UNC-43 co-localizes with F-actin at the oocyte cortex and it is enriched at the oocyte/oocyte interface, similar to the distribution of GFP::NMR-1 and VAB-1::GFP(see Expr3782). CaMKII-pT staining is also detected at the sheath/oocyte interface of wild-type gonads. The CaMKII-pT staining pattern contrasts with that of MAPK-YT, which is uniformly distributed throughout the oocyte cytoplasm. In wild-type gonads, it is difficult to determine whether UNC-43 is expressed in sheath cells, owing to their close proximity to oocytes and the thinness of the sheath. To test whether pT284 UNC-43 is in sheath cells, fem-3(q20gf) mutant gonads were stained with anti-CaMKII-pT. When grown at the restrictive temperature, fem-3(q20gf) mutant gonads contain sperm and sheath cells, but not oocytes. CaMKII-pT stains the somatic cells surrounding sperm in fem-3(q20gf) gonads. These results indicate that UNC-43 is phosphorylated in sheath cells and in oocytes when sperm are present. In oocytes, pT284 UNC-43 co-localizes with F-actin at the cortex.

• Primary Identifier: Expr1147
• Pattern: The antibody specifically stained the synapse-rich nerve ring, ventral nerve cord and dorsal nerve cord in wild-type but not in unc-43(n1186) or unc-43(e755) animals.

• Primary Identifier: Chronogram817
• Remark: Original chronogram file: chronogram.1858.xml
• Reporter Gene: [K11E8.1:gfp] transcriptional fusion.

• Primary Identifier: Expr1154316
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2017876
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1018767
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr3674
• Subcellular Localization: The resulting UNC-43::CFP protein was detected in neuron cell bodies and out at neurites, where it formed clusters along the ventral nerve cord

40 GO Annotation

16 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00006779
• Start: 10324254
• End: 10350217
• Strand: -1

40 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 25964

1 Sequence Ontology Term

• Name: gene

15 Strains

• WBStrain00022784
• WBStrain00022482
• WBStrain00026984
• WBStrain00026985
• WBStrain00026793
• WBStrain00029053
• WBStrain00030736
• WBStrain00030756
• WBStrain00030762
• WBStrain00030763
• WBStrain00036282
• WBStrain00040667
• WBStrain00004925
• WBStrain00004928
• WBStrain00004165

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_10350218..10350589
• Length (nt): 372
• Chromosome Location: IV: 10350218-10350589
• Organism: Caenorhabditis elegans