WormMine: Gene WBGene00016735

• WormBase Gene ID: WBGene00016735
• Gene Name: fhod-1
• Sequence Name: C46H11.11
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable actin filament binding activity. Involved in actin filament organization and embryonic body morphogenesis. Located in actin cytoskeleton. Expressed in muscle cell; pharyngeal muscle cell; and seam cell. Human ortholog(s) of this gene implicated in familial hypertrophic cardiomyopathy. Is an ortholog of human FHOD1 (formin homology 2 domain containing 1) and FHOD3 (formin homology 2 domain containing 3).
• Biotype: SO:0001217
• Genetic Position: I :-0.421363 ±0.000374
• Length (nt): 10581

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00016735

Genomics

8 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C46H11.11b.1	C46H11.11b.1	3937	I: 5058251-5068829
Transcript:C46H11.11a.1	C46H11.11a.1	4411	I: 5058251-5068829
Transcript:C46H11.11d.1	C46H11.11d.1	3751	I: 5058490-5068831
Transcript:C46H11.11e.1	C46H11.11e.1	5097	I: 5058620-5066744
Transcript:C46H11.11g.1	C46H11.11g.1	4623	I: 5058620-5066744
Transcript:C46H11.11h.1	C46H11.11h.1	4572	I: 5058620-5066744
Transcript:C46H11.11f.1	C46H11.11f.1	5050	I: 5058620-5066748
Transcript:C46H11.11c.1	C46H11.11c.1	4092	I: 5058620-5068828

Other

8 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C46H11.11d	C46H11.11d	3618	I: 5058620-5058675
CDS:C46H11.11h	C46H11.11h	4572	I: 5058620-5058675
CDS:C46H11.11c	C46H11.11c	4092	I: 5058620-5058675
CDS:C46H11.11a	C46H11.11a	4041	I: 5058620-5058675
CDS:C46H11.11b	C46H11.11b	3567	I: 5058620-5058675
CDS:C46H11.11e	C46H11.11e	5097	I: 5058620-5058675
CDS:C46H11.11f	C46H11.11f	5046	I: 5058620-5058675
CDS:C46H11.11g	C46H11.11g	4623	I: 5058620-5058675

6 RNAi Result

• WBRNAi00042624
• WBRNAi00022306
• WBRNAi00029884
• WBRNAi00111040
• WBRNAi00111039
• WBRNAi00117058

125 Allele

• gk962706
• gk963902
• WBVar01431535
• gk922020
• gk609429
• gk627319
• gk562128
• gk465943
• gk937117
• gk523155
• gk824121
• gk757309
• gk521477
• gk472054
• gk702318
• gk850438
• gk678270
• gk548910
• gk701581
• gk429541
• gk324832
• gk451761
• gk470682
• gk695176
• gk766938
• gk544961
• gk707976
• gk697906
• gk927361
• gk324833

1 Chromosome

• WormBase ID: I
• Organism: Caenorhabditis elegans
• Length (nt): 15072434

1 Chromosome Location

• Feature . Primary Identifier: WBGene00016735
• Start: 5058251
• End: 5068831
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrI_5056040..5058250
• Length (nt): 2211
• Chromosome Location: I: 5056040-5058250
• Organism: Caenorhabditis elegans

195 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
	Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc).	DESeq2, fold change >= 2, FDR <= 0.01.	WBPaper00056826:SGP_biased
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO.	Fold change > 2.	WBPaper00064306:Agaro-oligosaccharides_upregulated
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts depleted in purified oocyte P bodies comparing to in the whole animal.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_WholeAnimal_depleted
	Transcripts that showed significantly decreased expression in dissected female germline comparing to in dissected male germline.	Log2 Fold change > 2 or <-1, p-value < 0.05.	WBPaper00053599:female_vs_male_downregulated
	Transcripts that showed significantly increased expression in oocyte germline cells comparing to in mitosis germline cells.	Log2 Fold change > 2 or <-1, p-value < 0.05.	WBPaper00053599:oocyte_vs_mitosis_upregulated
	Genes that showed oscillating mRNA expression level throughout the 16 hour time courses from L3 larva to young adult.	The following three lines of R code were used to perform the classification: increasing <-2*amplitude-PC1 < -1.7; oscillating <-!increasing & (amplitude > 0.55); flat <-!increasing & !oscillating; Note that the amplitude of a sinusoidal wave corresponds to only half the fold change between trough and peak.	WBPaper00044736:oscillating_dev_expression
	Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:hda-1(ne4752)_upregulated
	Transcripts that showed significantly increased expression in mep-1(ne4629[MEP-1-GFP-Degron]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:mep-1(ne4629)_upregulated
	Transcripts that showed significantly altered expression at URX, AQR, and PQR neurons in camt-1(ok515) animals comparing to in wild type AX1888-1 strain.	RNA-seq data were mapped using PRAGUI - a Python 3-based pipeline for RNA-seq data analysis.	WBPaper00061902:camt-1(ok515)_regulated_URX-AQR-PQR
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
	Transcripts that showed significantly increased expression in srbc-48(ac23);kyIs262;fer-1(b232ts) comparing to in kyIs262;fer-1(b232ts), 24h after infection with P.aeruginosa.	DESeq2, FDR <0.05, fold change > 2.	WBPaper00059664:srbc-48(ac23)_upregulated
	Transcripts that showed altered expression in cat-1(RNAi) animals comparing to control animals injected with empty vector.	p-value <= 0.05	WBPaper00066902:cat-1(RNAi)_regulated
	Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Allantoin_downregulated
	Transcripts that showed significantly decreased expression in set-2(tm1630) animals at embryo stage, comparing to in N2 animals.	DESeq2 (v2.1.8.3) was used to determine DE genes and to generate principal component and scatter plots. DE genes with FDR < 0.05 were analysed using g:Profiler with Bonferroni correction.	WBPaper00060014:set-2(tm1630)_downregulated
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(-), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(-)_vs_control_day2-adult

12 Expression Patterns

• Primary Identifier: Expr5517
• Remark: Strain: BC14610
• Reporter Gene: [fhod-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTGAATTTTGCCTCCTAAAAAC] 3' and primer B 5' [TGTCGTCGTCGTCGATTCT] 3'.
• Pattern: Adult Expression: pharynx; intestine; Reproductive System; vulval muscle; Larval Expression: pharynx; intestine; Reproductive System; developing vulva

• Primary Identifier: Expr10195
• Pattern: FHOD-1::GFP is localized in F-actin rich muscles, including BWMs, pharyngeal muscles, and vulval muscles. FHOD-1 is present diffusely in the elongated bands of F-actin rich embryonic myoblasts. FHOD-1 is not detectable in F-actin rich BWMs of L1 larvae but appears as puncta along muscle edges and as striations across the BWM contractile lattice in L2 and L3 larvae.

• Primary Identifier: Expr11646
• Pattern: Two polyclonal antibodies, raised to either a peptide in the central region or at the C terminus of FHOD-1, revealed that the protein is expressed in the lateral epidermis in a circumferential pattern, similar to the actin cytoskeleton in these cells. Co-staining with the adherens junction marker,anti-AJM-1, which highlights epithelial boundaries, demonstrated that FHOD-1 was present in the lateral epidermal cells. Anti-FHOD-1 staining showed a filamentous pattern. This pattern was similar to human anti-FHOD1 staining in cultured cells where staining is seen along the entire length of stress fibers rather than just their distal ends. FHOD-1 expression was apparent only relatively late in elongation, from the 2.5-fold stage.

• Primary Identifier: Expr15795
• Pattern: We observed FHOD-1::GFP in BWMs of animals from embryonic 1.75-fold stage through L1. FHOD-1 localized diffusely in younger stage embryonic BWM when sarcomeric components start to polarize and assemble into sarcomeres, and gradually appeared more punctuate at the edges of the F-actin-rich contractile lattices from later embryogenesis through early larval development, when sarcomeres mature. Similar patterns of fluorescence were visible in live embryos and larvae expressing FHOD-1::GFP. Thus, FHOD-1 is present through all stages of BWM development when sarcomere assembly is occurring.

• Primary Identifier: Expr11795
• Subcellular Localization: FHOD-1 localizes near or on Z lines in BWM cells.

• Primary Identifier: Expr13729
• Pattern: FHOD-1 is localized near the Z lines (where the actin thin filaments are anchored into the plasma membrane) within the contractile lattice, and along the edges of growing body wall muscle cells.

• Primary Identifier: Expr2011756
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1037186
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr2029994
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Chronogram1936
• Remark: Original chronogram file: chronogram.856.xml
• Reporter Gene: [C46H11.11:gfp] transcriptional fusion.

• Primary Identifier: Expr1013284
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1146609
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

8 GO Annotation

7 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00016735
• Start: 5058251
• End: 5068831
• Strand: -1

8 Ontology Annotations

2 Regulates Expr Cluster

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in fhod-1(tm2363) comparing to in N2 animals.	Differentially expressed genes (defined by false discovery rate (FDR) step up <= 0.05, fold change >1.5) were identified by Gene-Specific Analysis.	WBPaper00060634:fhod-1(tm2363)_upregulated
	Transcripts that showed significantly decreased expression in fhod-1(tm2363) comparing to in N2 animals.	Differentially expressed genes (defined by false discovery rate (FDR) step up <= 0.05, fold change >1.5) were identified by Gene-Specific Analysis.	WBPaper00060634:fhod-1(tm2363)_downregulated

1 Sequence

• Length: 10581

1 Sequence Ontology Term

• Name: gene

1 Strains

• WBStrain00003122

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrI_5068832..5073578
• Length (nt): 4747
• Chromosome Location: I: 5068832-5073578
• Organism: Caenorhabditis elegans