WormMine: Gene WBGene00006476

• WormBase Gene ID: WBGene00006476
• Gene Name: rhgf-2
• Sequence Name: T08H4.1
• Brief Description: rhgf-2 encodes a Rho guanyl-nucleotide exchange factor (RhoGEF) with similarity to the mammalian PLEKHG5/Tech/Syx RhoGEFs; rhgf-2 is required for embryonic morphogenesis, larval development, and regulation of locomotion; when expressed in mammalian neuronal tissue culture cells, RHGF-2 induces cell rounding inhibits neurite outgrowth; RHGF-2 functions as a RhoGEF for the RHO-1 GTPase; RHGF-2 physically interacts with the multi-PDZ domain scaffold protein MPZ-1; RHGF-2 is expressed in many, but not all, C. elegans neurons from the 1.5-fold stage of embryogenesis through adulthood; in nerve ring axons, RHGF-2 expression overlaps with that of MPZ-1.
• Organism: Caenorhabditis elegans
• Automated Description: Enables guanyl-nucleotide exchange factor activity and small GTPase binding activity. Involved in several processes, including Rho protein signal transduction; embryonic body morphogenesis; and positive regulation of transcription by RNA polymerase II. Located in axon and cell body. Expressed in several structures, including pharyngeal cell; seam cell; somatic nervous system; tail; and touch receptor neurons. Human ortholog(s) of this gene implicated in Charcot-Marie-Tooth disease recessive intermediate C and autosomal recessive distal hereditary motor neuronopathy 4. Is an ortholog of human PLEKHG5 (pleckstrin homology and RhoGEF domain containing G5).
• Biotype: SO:0001217
• Genetic Position: II :-5.62283±
• Length (nt): 27069

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00006476

Genomics

9 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:T08H4.1b.1	T08H4.1b.1	3184	II: 4100785-4127529
Transcript:T08H4.1a.1	T08H4.1a.1	3501	II: 4100788-4127849
Transcript:T08H4.1b.2	T08H4.1b.2	3512	II: 4107219-4127529
Transcript:T08H4.1a.3	T08H4.1a.3	3792	II: 4107263-4127853
Transcript:T08H4.1c.1	T08H4.1c.1	3450	II: 4107281-4127529
Transcript:T08H4.1b.3	T08H4.1b.3	3103	II: 4109207-4127529
Transcript:T08H4.1a.2	T08H4.1a.2	3420	II: 4109210-4127849
Transcript:T08H4.1a.4	T08H4.1a.4	3375	II: 4111724-4127853
Transcript:T08H4.1a.5	T08H4.1a.5	2995	II: 4120255-4127853

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:T08H4.1c	T08H4.1c	3450	II: 4107281-4107630
CDS:T08H4.1b	T08H4.1b	3024	II: 4109286-4109375
CDS:T08H4.1a	T08H4.1a	2589	II: 4120337-4120387

11 RNAi Result

• WBRNAi00052907
• WBRNAi00052908
• WBRNAi00018478
• WBRNAi00018479
• WBRNAi00026242
• WBRNAi00026243
• WBRNAi00026244
• WBRNAi00026245
• WBRNAi00027466
• WBRNAi00027467
• WBRNAi00103518

546 Allele

• gk963801
• gk963053
• h14349
• h9692
• gk139975
• otn11916
• WBVar01304952
• gk960291
• WBVar02121558
• WBVar02124877
• WBVar01370219
• WBVar01370184
• WBVar01370100
• WBVar01370111
• WBVar01370089
• WBVar01370067
• WBVar01370078
• WBVar01370045
• WBVar01370056
• WBVar01370022
• WBVar01370033
• WBVar01370000
• WBVar01437321
• WBVar01437327
• WBVar01437328
• WBVar01437330
• WBVar01546667
• WBVar01546668
• WBVar01546669
• WBVar01719469

1 Chromosome

• WormBase ID: II
• Organism: Caenorhabditis elegans
• Length (nt): 15279421

1 Chromosome Location

• Feature . Primary Identifier: WBGene00006476
• Start: 4100785
• End: 4127853
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

178 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
Bacteria infection: Enterococcus faecalis	Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
	Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc).	DESeq2, fold change >= 2, FDR <= 0.01.	WBPaper00056826:SGP_biased
	Coexpression clique No. 203, sre-33-ZK1025.1_8337, on the genome-wide coexpression clique map for the nematode GPL200 platform.	All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform.	WBPaper00061527:sre-33-ZK1025.1_8337
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
	Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_SM
	Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO.	Fold change > 2.	WBPaper00064306:Agaro-oligosaccharides_upregulated
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Top 300 transcripts enriched in excretory duct, excretory pore according to single cell RNAseq.	Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm.	WBPaper00061340:Excretory_duct_and_pore
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:A-class-motor-neurons_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L2-larva_expressed
	Transcripts that showed significantly increased expression in hpk-1(pk1393) comparing to in N2 at adult day 2.	DESeq 2, fold change > 2, FDR < 0.05.	WBPaper00065581:hpk-1(pk1393)_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed
	Transcripts that showed significantly increased expression in mep-1(ne4629[MEP-1-GFP-Degron]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:mep-1(ne4629)_upregulated
	Transcripts that showed significantly increased expression in ubc-9(ne4833[ubc-9(G56R)] in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:ubc-9(ne4833)_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:glr-1(+)-neurons_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:hypodermis_L3-L4-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:PVD-OLL-neurons_L3-L4-larva_expressed

15 Expression Patterns

• Primary Identifier: Expr4307
• Pattern: Some neuronal expression.

• Primary Identifier: Expr6642
• Remark: Strain: BC12029
• Reporter Gene: [T08H4.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAAACGTTCAATCTATGCTCATCA] 3' and primer B 5' [TCGTTGCTCGCTCGTTACT] 3'.
• Pattern: Adult Expression: Nervous System; head neurons; unidentified cells in tail ; Larval Expression: Nervous System; head neurons; unidentified cells in tail

• Primary Identifier: Expr6643
• Remark: Strain: BC12668
• Reporter Gene: [T08H4.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAAACGTTCAATCTATGCTCATCA] 3' and primer B 5' [TCGTTGCTCGCTCGTTACT] 3'.
• Pattern: Adult Expression: Nervous System; head neurons; Larval Expression: Nervous System; head neurons

• Primary Identifier: Expr9974
• Pattern: GFP fluorescence appeared exclusively neuronal during development from about the 1.5 fold stage of embryogenesis through to the adult. No obvious RHGF-2s::GFP fluorescence was visible in the earlier stages of embryogenesis. Many, but not all, of the 302 C. elegans hermaphrodite neurons expressed GFP in the transgenic animals examined. Several cell bodies in head and tail ganglia and many neuronal processes in the nerve ring and ventral cord were visible, with the GFP fluorescence for most cells distributed diffusely throughout the cell, although there were instances of more punctate fluorescence within some cell bodies and processes, particularly in the ventral cord. Neurons that were positively identified in late larval/adult animals based on their position and morphology were the ALM, AVM, PLM and PVM mechanosensory neurons and the BDUs. Expression from the ciliated sensory neurons, most ventral cord motor neurons and neurons with cell bodies in the mid-body of the animal such as the CANs, PDEs and SDQs, for example, was notably absent from transgenic animals observed at late larval and adult stages.

• Primary Identifier: Expr9975
• Pattern: Expression driven by the 5' regulatory regions of the full length rhgf-2l transcript was examined using a tagRFP transcriptional fusion reporter (rhgf-2lp::rfp). Fluorescence from rhgf-2lp::rfp transgenic animals was restricted to the nervous system, but to a smaller subset of neurons that partially overlapped with rhgf-2s::gfp expression (Expr9974).

• Primary Identifier: Expr8759
• Remark: No detailed description on expression pattern in other tissue or life stages.. Picture: N.A.
• Pattern: Not expressed in gonad.

• Primary Identifier: Expr1032645
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr12331
• Pattern: Wild-type animals showed ubiquitous and uniform expression restricted to the cytoplasm as early as the two cell stage. This pattern persisted to the onset of elongation. RHGF-2 protein expression may be stronger in the seam cells post-elongation, around the 3-fold stage. The RHGF-2 antibody also detected expression in the nervous system starting around the 1.5 fold stage. RHGF-2 also lined the borders of cell in the pharyngeal lumen.

• Primary Identifier: Expr1038873
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr1024564
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1156509
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr1156508
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2015336
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1013102
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2033570
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

18 GO Annotation

4 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00006476
• Start: 4100785
• End: 4127853
• Strand: 1

18 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 27069

1 Sequence Ontology Term