Genomics
12 Transcripts
WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|
Transcript:H20J18.1h.2 | H20J18.1h.2 |
3477
![]() |
X: 12503887-12509225 |
Transcript:H20J18.1g.1 | H20J18.1g.1 |
3425
![]() |
X: 12503887-12509221 |
Transcript:H20J18.1f.1 | H20J18.1f.1 |
3999
![]() |
X: 12503887-12525789 |
Transcript:H20J18.1f.2 | H20J18.1f.2 |
3633
![]() |
X: 12503887-12514054 |
Transcript:H20J18.1a.3 | H20J18.1a.3 |
4030
![]() |
X: 12503887-12525772 |
Transcript:H20J18.1h.1 | H20J18.1h.1 |
3568
![]() |
X: 12503893-12514055 |
Transcript:H20J18.1e.1 | H20J18.1e.1 |
3539
![]() |
X: 12503894-12509225 |
Transcript:H20J18.1a.2 | H20J18.1a.2 |
3569
![]() |
X: 12503897-12509219 |
Transcript:H20J18.1a.1 | H20J18.1a.1 |
3665
![]() |
X: 12503897-12514048 |
Transcript:H20J18.1b.1 | H20J18.1b.1 |
3450
![]() |
X: 12503900-12509217 |
Transcript:H20J18.1d.1 | H20J18.1d.1 |
3476
![]() |
X: 12503901-12509217 |
Transcript:H20J18.1c.1 | H20J18.1c.1 |
3246
![]() |
X: 12504620-12525721 |
Other
8 CDSs
WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|
CDS:H20J18.1b | H20J18.1b |
2730
![]() |
X: 12504620-12504733 |
CDS:H20J18.1d | H20J18.1d |
2757
![]() |
X: 12504620-12504733 |
CDS:H20J18.1h | H20J18.1h |
2736
![]() |
X: 12504620-12504733 |
CDS:H20J18.1c | H20J18.1c |
3246
![]() |
X: 12504620-12504733 |
CDS:H20J18.1a | H20J18.1a |
2844
![]() |
X: 12504620-12504733 |
CDS:H20J18.1e | H20J18.1e |
2805
![]() |
X: 12504620-12504733 |
CDS:H20J18.1f | H20J18.1f |
2796
![]() |
X: 12504620-12504733 |
CDS:H20J18.1g | H20J18.1g |
2688
![]() |
X: 12504620-12504733 |
382 Allele
Public Name |
---|
gk964260 |
gk964029 |
gk962707 |
gk964028 |
gk963810 |
WBVar01928354 |
otn9170 |
WBVar01759656 |
WBVar01690893 |
WBVar01690892 |
WBVar01690895 |
WBVar01690894 |
WBVar01690897 |
WBVar01690896 |
WBVar01690899 |
WBVar01690898 |
WBVar01690901 |
WBVar01690900 |
WBVar02066067 |
WBVar01693686 |
WBVar00243289 |
sa248 |
sa317 |
sa318 |
WBVar02078961 |
tm11244 |
WBVar01787283 |
gk437183 |
WBVar01787284 |
gk375528 |
1 Chromosome Location
Feature . Primary Identifier |
Start | End | Strand |
---|---|---|---|
WBGene00004739 | 12503887 | 12525789 | -1 |
3 Data Sets
Name | URL |
---|---|
WormBaseAcedbConverter | |
C. elegans genomic annotations (GFF3 Gene) | |
Panther orthologue and paralogue predictions |
1 Downstream Intergenic Region
WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
---|---|---|---|---|---|
intergenic_region_chrX_12503339..12503886 | 548 | X: 12503339-12503886 | Caenorhabditis elegans |
214 Expression Clusters
Regulated By Treatment | Description | Algorithm | Primary Identifier |
---|---|---|---|
Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. | DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. | WBPaper00060811:L1_vs_adult_upregulated_neural | |
Transcripts of coding genes that showed significantly decreased expression in muscle. | DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. | WBPaper00062325:muscle_depleted_coding-RNA | |
Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. | DESeq. False discovry rate (FDR) < 0.1. | WBPaper00048988:neuron_expressed | |
adult vs dauer larva | Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. | N.A. | WBPaper00050488:adult_vs_dauer_regulated_N2_20C |
mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. | Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. | WBPaper00045420:fertilization_downregulated_transcript | |
TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood. | SAM | WBPaper00031040:TGF-beta_adult_upregulated | |
Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. | DESEQ2, fold change > 2 and FDR < 0.01. | WBPaper00062103:neuron_enriched | |
Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals. | Fold change > 2, FDR < 0.01. | WBPaper00065993:glp-1(e2141)_upregulated | |
Bacteria infection: Enterococcus faecalis | Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50. | For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. | WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray |
Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite. | DESeq2(v1.14.1), fold change > 2, p-value < 0.05 | WBPaper00055354:Rifampicin_upregulated | |
Coexpression clique No. 203, sre-33-ZK1025.1_8337, on the genome-wide coexpression clique map for the nematode GPL200 platform. | All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform. | WBPaper00061527:sre-33-ZK1025.1_8337 | |
Genome-wide analysis of developmental and sex-regulated gene expression profile. | self-organizing map | cgc4489_group_18 | |
Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:arcade_intestinal-valve_expressed | |
Genes significantly enriched in NSM neurons (isolated by FACS) versus the reference, according to RNAseq analysis towards total RNA. | Gene expression quantification and differential expression was analyzed using cufflinks v2.2.1. Enriched contains only genes significantly enriched (differentially expressed >= 2.4 fold in total RNA or >= 3.2 fold in DSN treated total RNA) in the NSM neurons versus the reference. | WBPaper00045974:NSM_enriched_totalRNA_RNAseq | |
Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:body-muscle_expressed | |
Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:GABAergic-neuron_expressed | |
Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:hypodermis_expressed | |
Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:intestine_expressed | |
Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:NMDA-neuron_expressed | |
Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:pharynx_expressed | |
Genes with expression level regulated by genotype (N2 vs CB4856) and age at old adults stage (214 hours at 24 centigrade). | For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). | WBPaper00040858:eQTL_age_regulated_aging | |
Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:seam_expressed | |
Transcripts detected in germline isolated from day-1 adult hermaphrodite animals. | All three experiments have CPM >= 1. | WBPaper00067147:germline_expressed | |
Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO. | Fold change > 2. | WBPaper00064306:Agaro-oligosaccharides_upregulated | |
Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. | DESeq2, fold change > 2, p-value < 0.01. | WBPaper00061203:sin-3(tm1276)_upregulated | |
Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2. | DEseq 1.18.0, adjusted p-value < 0.05. | WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated | |
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure. | Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2). | DEseq 1.18.0, adjusted p-value < 0.05. | WBPaper00056471:S.aureus-4h_upregulated_N2 |
Top 300 transcripts enriched in ABalppppppa, ABpraaapppa according to single cell RNAseq. | Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm. | WBPaper00061340:ASE_parent | |
Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. | DESeq2, fold change > 2, adjusted p-value < 0.01 | WBPaper00058598:sin-3(tm1276)_downregulated | |
Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy. | Cufflinks | WBPaper00065120:body-muscle-transcriptome |
12 Expression Patterns
Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
---|---|---|---|---|
Strain: BC14545 | [scd-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGCACAATATGATCGCTGA] 3' and primer B 5' [CGTTACCCACGTTGATTTCTG] 3'. | Expr6278 | Adult Expression: intestine; Reproductive System; vulva other; spermatheca; body wall muscle; Nervous System; head neurons; neurons along body; tail neurons; Embryo Expression: neurons along body; tail neurons; Larval Expression: intestine; body wall muscle; Nervous System; head neurons; neurons along body; tail neurons; | |
Expr1019547 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | |||
Expr1033296 | Tiling arrays expression graphs | |||
Expr1032339 | Tiling arrays expression graphs | |||
Expr1153177 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015 | |||
Expr2015623 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
Expr2000877 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
Expr1014124 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | |||
Expr2033858 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
Original chronogram file: chronogram.871.xml | [H20J18.1:gfp] transcriptional fusion. | Chronogram1953 | ||
Expr1144773 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015 | |||
Expr2019095 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). |