WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: pharynx; pharyngeal gland cells; intestine; stomato-intestinal muscle; anal depressor muscle; Reproductive System; uterus; uterine-seam cell; uterine muscle; vulval muscle; body wall muscle; head mesodermal cell; hypodermis; seam cells; coelomocytes; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal gland cells; intestine; Reproductive System; distal tip cell; developing vulva; developing uterus; body wall muscle; head mesodermal cell; hypodermis; seam cells; unidentified cells in head; unidentified cells in tail ; Primary Identifier  Expr6964
Remark  Also expressed in (comments from author) : Mosaic population.Sometimes cell bodies in head, perhaps neural? or arcade? Strain: BC12912 Reporter Gene  [Y41D4A.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATCGAGAAAAACTCTGCAATATCC] 3' and primer B 5' [TACCCGGATGGCTTTGAA] 3'.

21 Anatomy Terms

Definition Name Synonym Primary Identifier
A chain of very large cuboidal cells forming a wide central lumen in which food arrives from the posterior pharynx, is digested, and from which waste products proceed to the rectum. Intestinal rings form in groups of two and four cells surrounding the common lumen; thus the epithelium is only one cell deep at any point, with neighboring cells firmly secured to their neighbors by apical adherens junctions. These cells have very large nuclei and many large vacuoles, yolk granules, and other inclusions; the latter increase in number and electron density as the animal ages. intestine gut WBbt:0005772
female genital. vulva   WBbt:0006748
Epidermal layer. hypodermis epidermis WBbt:0005733
Longitudinal bands of muscle cells surrounding animal body, with one band running in each quadrant of the body, regulated contraction and relaxation of these muscles cause locomotion. body wall musculature body muscle WBbt:0005813
muscle associated with hermaphrodite vulva. vulval muscle   WBbt:0005821
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine. pharynx esophagus WBbt:0003681
Posterior distal tip cell, inhibit meiosis in neighbouring germ cells, lead gonad during morphogenesis, herm gonad posterior distal tip cell gon herm dtc P WBbt:0004506
Anterior distal tip cell, inhibit meiosis in neighbouring germ cells, lead gonad during morphogenesis, herm gonad anterior distal tip cell gon herm dtc A WBbt:0004520
a single, H-shaped cell which lies just above the anus and connects the roof of the anal canal to the dorsal bodywall; its contractions act to increase the size of the anal opening by lifting the roof of the rectum and hence facilitate expulsion of intestinal contents. anal depressor muscle dilator muscle WBbt:0004292
The organ in which the eggs are developed and protected until laid. uterus   WBbt:0006760
a group of hypodermal cells that lie along the apical midline of the hypodermis, at the extreme left and right sides between nose and tail seam cell lateral hypodermis WBbt:0005753
Secretory gland cell of the pharynx Pharyngeal gland cell   WBbt:0005788
A free-floating spherical cell lying in the pseudocoelomic cavity of larvae and adult C. elegans which can endocytose many compounds, possibly for immune surveillance. There are six coelomocytes in adult hermaphrodites, and they display prominent cytoplasmic inclusions and vacuoles. coelomocyte   WBbt:0005751
posterior region, from rectum to the end tail   WBbt:0005741
muscle lining of the uterine wall. uterine muscle   WBbt:0005342
membranous cell attaches the uterus to the lateral epidermis (seam) and forms a thin laminar process dorsal to the vulva. formed by fusion of eight pi cell progeny and AC. uterine seam cell utse WBbt:0006789
Head mesodermal cell, function unknown head mesodermal cell hmc WBbt:0004697
anterior-most body region containing the pharynx. head   WBbt:0005739
  reproductive system   WBbt:0005747
left intestinal muscle cell, attach to intestine and body wall anterior to anus mu_int_L lineage name: ABplpppppaa WBbt:0003833
right intestinal muscle cell, attach to intestine and body wall anterior to anus mu_int_R lineage name: MSppaapp WBbt:0003822

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00021506 Y41D4A.4 Y41D4A.4 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023