WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00004831 Gene Name  slo-2
Sequence Name  ? F08B12.3 Brief Description  slo-2 encodes a high conductance, sodium-activated potassium channel; when expressed in Xenopus oocytes, SLO-2 exhibits a synergistic dependence on both chloride and calcium ions for activation; expression of a dominant negative SLO-2 mutant can interfere with activity of SLO-1, a second high conductance potassium channel, suggesting that the two channels can form functional heteromultimers; a SLO-2::GFP fusion protein is expressed in body wall, vulval, and pharyngeal/intestinal valve muscles, nerve ring processes, and some motor neurons in the ventral nerve cord; SLO-2 expression largely overlaps with that of SLO-1.
Organism  Caenorhabditis elegans Automated Description  Enables calcium-activated potassium channel activity and outward rectifier potassium channel activity. Involved in positive regulation of neurotransmitter secretion and potassium ion transport. Located in axon. Expressed in amphid neurons; body wall musculature; motor neurons; nerve ring; and vulval muscle. Human ortholog(s) of this gene implicated in autosomal dominant nocturnal frontal lobe epilepsy 5; developmental and epileptic encephalopathy 14; and developmental and epileptic encephalopathy 57. Is an ortholog of human KCNT1 (potassium sodium-activated channel subfamily T member 1) and KCNT2 (potassium sodium-activated channel subfamily T member 2).
Biotype  SO:0001217 Genetic Position  X :3.51722 ±0.06473
Length (nt)  ? 11327
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00004831

Genomics

8 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:F08B12.3b.1 F08B12.3b.1 3725   X: 11394605-11400993
Transcript:F08B12.3a.1 F08B12.3a.1 3759   X: 11394607-11400993
Transcript:F08B12.3d.1 F08B12.3d.1 3442   X: 11394608-11401307
Transcript:F08B12.3c.1 F08B12.3c.1 3402   X: 11394609-11401561
Transcript:F08B12.3h.1 F08B12.3h.1 3393   X: 11394699-11403796
Transcript:F08B12.3g.1 F08B12.3g.1 3432   X: 11394699-11404200
Transcript:F08B12.3f.1 F08B12.3f.1 3378   X: 11394699-11404944
Transcript:F08B12.3e.1 F08B12.3e.1 3423   X: 11394699-11405931
 

Other

8 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:F08B12.3a F08B12.3a 3360   X: 11394699-11394846
CDS:F08B12.3h F08B12.3h 3393   X: 11394699-11394846
CDS:F08B12.3f F08B12.3f 3378   X: 11394699-11394846
CDS:F08B12.3b F08B12.3b 3324   X: 11394699-11394846
CDS:F08B12.3c F08B12.3c 3261   X: 11394699-11394846
CDS:F08B12.3d F08B12.3d 3351   X: 11394699-11394846
CDS:F08B12.3e F08B12.3e 3423   X: 11394699-11394846
CDS:F08B12.3g F08B12.3g 3432   X: 11394699-11394846

3 RNAi Result

WormBase ID
WBRNAi00000745
WBRNAi00043963
WBRNAi00022321

167 Allele

Public Name
gk964260
gk964029
gk962707
gk964028
gk963810
WBVar01928340
WBVar01928341
WBVar01928342
WBVar01928343
gk963109
gk963110
WBVar01759462
WBVar01690491
WBVar01690490
gk379143
gk381131
gk720109
gk294111
WBVar01825273
gk951935
gk951936
gk951937
WBVar00068355
nj131
WBVar00068360
nj275
ttTi9348
ok5931
WBVar00236832
WBVar00236831

1 Chromosome

WormBase ID Organism Length (nt)
X Caenorhabditis elegans 17718942  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00004831 11394605 11405931 -1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

0 Downstream Intergenic Region

191 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. WBPaper00060811:L1_vs_adult_upregulated_neural
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:all-neurons_L1-larva_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. WBPaper00045420:fertilization_downregulated_transcript
  TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood. SAM WBPaper00031040:TGF-beta_adult_upregulated
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:AVE-neuron_L1-larva_expressed
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_Food
  Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. DESEQ2, fold change > 2 and FDR < 0.01. WBPaper00062103:neuron_enriched
  Genes that showed increased expression in wdr-5(ok1417) comparing with in N2. Statistical analysis for misexpression was performed using a moderated t test from the package limma. All genes with a false discovery rate (FDR) of <= 5% (p <= 0.05) were selected as differentially regulated. WBPaper00045861:wdr-5(ok1417)_upregulated
  Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals. Fold change > 2, FDR < 0.01. WBPaper00065993:glp-1(e2141)_upregulated
  Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:body-muscle_expressed
  Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:GABAergic-neuron_expressed
  Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage. edgeR, fold change > 2, FDR < 0.05 WBPaper00060909:atfs-1(cmh15)_downregulated
  Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:intestine_expressed
  Maternal class (M): genes that are called present in at least one of the three PC6 replicates. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_M
  Genes with expression level regulated by genotype (N2 vs CB4856) at old adults stage (214 hours at 24 centigrade). For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). WBPaper00040858:eQTL_regulated_aging
  Genes with expression level regulated by genotype (N2 vs CB4856) at Late reproduction stage (96 hours at 24 centigrade). Authors permuted transcript values and used a genome-wide threshold of log10 P-value = 2, which resembles a false discovery rate (FDR) of 0.0118. WBPaper00040858:eQTL_regulated_reproductive
  Transcripts that showed significantly increased expression in rrf-3(pk1426) comparing to in N2 at embryo stage. DESeq2v 1.18.1, fold change > 1.5, adjusted p-value < 0.01. WBPaper00056169:rrf-3(pk1426)_upregulated_embryo
  Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_SM
Bacteria infection: Bacillus thuringiensis Transcripts that showed significantly increased expression in N2 animals infected by bacteria BMB171/Cry5Ba, an acrystalliferous Bt mutant BMB171 transformed with toxin gene cry5Ba on the shuttle vector pHT304, comparing to N2 animals infected by BMB171/pHT304. N.A. WBPaper00064229:B.thuringiensis-Cry5Ba_upregulated
  Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. DESeq2, fold change > 2, p-value < 0.01. WBPaper00061203:sin-3(tm1276)_upregulated
  Genes that showed significantly increased expression in daf-2(e1370);hel-1(gk148684) comparing to in hel-1(gk148684) To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs. WBPaper00047131:daf-2(e1370)_upregulated_hel-1(gk148684)-background
  Genes that showed significantly increased expression in daf-2(e1370) comparing to in N2. To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs. WBPaper00047131:daf-2(e1370)_upregulated_N2-background
  Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage. DESeq2 version 1.22.2, p < 0.05 WBPaper00064716:paraquat_downregulated
  Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage. DESeq WBPaper00053302:stavudine_24h_regulated
  Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. DESeq2, fold change > 2, adjusted p-value < 0.01 WBPaper00058598:sin-3(tm1276)_downregulated
  Transcripts depleted in purified oocyte P bodies comparing to in the whole animal. DESeq2, FDR < 0.05, fold change > 2. WBPaper00065975:P-body_vs_WholeAnimal_depleted
  Transcripts that showed significantly increased expression in sftb-1(cer6) deletion homozygous comparing to to in N2 animals at L4 larva stage. DESeq2, fold change > 2 WBPaper00058725:sftb-1(cer6)_downregulated
  Transcripts that showed significantly increased expression in xrep-4(lax137). DESeq2. Genes were selected if their p value < 0.01. WBPaper00066062:xrep-4(lax137)_upregulated

14 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Strain: BC10749 [slo-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCTGTATCACAAAAGCGTAAAAGC] 3' and primer B 5' [TGTCGTCCGAGATTTTTGC] 3'. Expr5677 Adult Expression: Reproductive System; uterine muscle; vulval muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; tail neurons; Larval Expression: body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;  
    Expr2034118 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
For reporter genes, transgenic marker was rol-6(su1006).   Expr524 Expressed in the neurons in the head, ventral nerve cord, nerve ring, and tail at L1 through adult. found in axonal processes and cell bodies.
Picture: Figure 2. Reporter gene fusion type not specified.   Expr7938 Expressed in ASE neurons and more than 10 other neurons.  
    Expr12699 slo-1 and slo-2 are expressed in both AWC neurons in the majority of wild-type animals, both slo-1 and slo-2 are asymmetrically expressed in AWCL or AWCR in a stochastic manner (AWCL>AWCR versus AWCL  
    Expr12700   The single copy insertion transgenes showed that GFP::UNC-2, SLO-1::TagRFP, SLO-1::GFP, SLO-2::TagRFP, and GFP::EGL-19 were mainly localized on the plasma membrane of AWC cell bodies and also displayed a punctate pattern along AWC axons.
    Expr13945 slo-2::mCherry expression was observed in AFD.  
    Expr1032405 Tiling arrays expression graphs  
This construct, lacking the slo-2 initiator methionine and upstream promoter, was co-injected together with the F08B12 cosmid containing the entire slo-2 gene and its promoter into the syncitial gonad of adult hermaphrodite N2 nematodes. Recombination between the slo-2:GFP construct and the cosmid was necessary for slo-2:GFP gene expression, and was enhanced by linearization of the slo-2:GFP segment and the cosmid at appropriate sites31. Control injections with the slo-2:GFP segment alone produced no GFP signal.   Expr1097 Transformed progeny expressed the slo-2:GFP fusion protein in many tissues including body-wall and vulva muscle (and possibly in pharyngeal muscle), processes of the nerve ring, and in some motor neurons.  
Original chronogram file: chronogram.1853.xml [F08B12.3:gfp] transcriptional fusion. Chronogram812    
    Expr2015885 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1027389 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr1147937 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr1147939 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  

15 GO Annotation

Annotation Extension Qualifier
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  enables
  enables
  enables
  located_in
  located_in
  located_in
  located_in
  located_in
  enables
  enables

7 Homologues

Type
orthologue
orthologue
orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00004831 11394605 11405931 -1

15 Ontology Annotations

Annotation Extension Qualifier
  involved_in
  involved_in
  involved_in
  involved_in
  involved_in
  enables
  enables
  enables
  located_in
  located_in
  located_in
  located_in
  located_in
  enables
  enables

0 Regulates Expr Cluster

1 Sequence

Length
11327

1 Sequence Ontology Term