WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: pharynx; intestine; rectal gland cells; rectal epithelium; Reproductive System; distal tip cell; vulval muscle; vulva other; spermatheca; gonad sheath cells; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; tail neurons; unidentified cells in tail ; Larval Expression: pharynx; intestine; rectal gland cells; rectal epithelium; Reproductive System; distal tip cell; developing gonad; developing vulva; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; tail neurons; unidentified cells in tail ; Primary Identifier  Expr5085
Remark  Strain: BC14118 Reporter Gene  [B0546.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCAAAGCACCGAAGACGTA] 3' and primer B 5' [CTTGAAACGCTGAGGATTCTG] 3'.

22 Anatomy Terms

Definition Name Synonym Primary Identifier
neuron with cell body associated with the ventral nerve cord. ventral cord neuron ventral cord motoneuron WBbt:0005300
an accordion-like tube that contains sperm and is the site of oocyte fertilization. spermatheca   WBbt:0005319
female genital. vulva   WBbt:0006748
A chain of very large cuboidal cells forming a wide central lumen in which food arrives from the posterior pharynx, is digested, and from which waste products proceed to the rectum. Intestinal rings form in groups of two and four cells surrounding the common lumen; thus the epithelium is only one cell deep at any point, with neighboring cells firmly secured to their neighbors by apical adherens junctions. These cells have very large nuclei and many large vacuoles, yolk granules, and other inclusions; the latter increase in number and electron density as the animal ages. intestine gut WBbt:0005772
Longitudinal bands of muscle cells surrounding animal body, with one band running in each quadrant of the body, regulated contraction and relaxation of these muscles cause locomotion. body wall musculature body muscle WBbt:0005813
Epidermal layer. hypodermis epidermis WBbt:0005733
muscle associated with hermaphrodite vulva. vulval muscle   WBbt:0005821
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine. pharynx esophagus WBbt:0003681
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities. nervous system   WBbt:0005735
Anterior distal tip cell, inhibit meiosis in neighbouring germ cells, lead gonad during morphogenesis, herm gonad anterior distal tip cell gon herm dtc A WBbt:0004520
Posterior distal tip cell, inhibit meiosis in neighbouring germ cells, lead gonad during morphogenesis, herm gonad posterior distal tip cell gon herm dtc P WBbt:0004506
neuron with its cell body situated in the head, excluding the pharynx. head neuron   WBbt:0006751
neuron with its cell body situated in the tail, posterior to rectum. tail neuron   WBbt:0006759
neuron of the pharyngeal nervous system. pharyngeal neuron   WBbt:0005439
a group of hypodermal cells that lie along the apical midline of the hypodermis, at the extreme left and right sides between nose and tail seam cell lateral hypodermis WBbt:0005753
the most extensive region of neuropil in the animal, consists of a large toroidal bundle of processes. nerve ring circumpharyngeal nerve ring WBbt:0006749
posterior region, from rectum to the end tail   WBbt:0005741
  rectal gland cell   WBbt:0005799
five pairs of thin gonadal sheath cells form a single layer covering the germ line component of each arm, each pair occupying a stereotyped position along the gonad proximal-distal axis. gonadal sheath cell   WBbt:0005828
organ producing either sperm or ova. gonad   WBbt:0005175
epithelium connecting intestine and anus. rectal epithelium   WBbt:0005800
  reproductive system   WBbt:0005747

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00015248 mai-2 B0546.1 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023