WormMine: Gene WBGene00004215

• WormBase Gene ID: WBGene00004215
• Gene Name: ptp-3
• Sequence Name: C09D8.1
• Brief Description: ptp-3 encodes a receptor-like tyrosine phosphatase orthologous to the LAR (Leukocyte Common Antigen Related, OMIM:179590) subfamily of receptor-like tyrosine phosphatases that contain extracellular immunoglobulin-like and fibronectin type III domains and have been implicated in linking cell adhesion to intracellular phosphotyrosine levels; PTP-3 plays a role in gastrulation and epidermal development and functions partly redundantly with the VAB-1 Eph receptor and ephrins VAB-2 and EFN-4 to regulate embryonic morphogenesis; PTP-3 is expressed in many tissues during early embryogenesis, but expression later becomes localized to neuronal processes and epithelial adherens junctions.
• Organism: Caenorhabditis elegans
• Automated Description: Enables protein tyrosine phosphatase activity. Involved in several processes, including embryonic morphogenesis; nervous system development; and neuroblast migration. Located in adherens junction and synapse. Expressed in embryonic cell; hypodermis; and nervous system. Human ortholog(s) of this gene implicated in artery disease (multiple); glucose metabolism disease (multiple); and obesity. Is an ortholog of human PTPRD (protein tyrosine phosphatase receptor type D) and PTPRF (protein tyrosine phosphatase receptor type F).
• Biotype: SO:0001217
• Genetic Position: II :3.13536 ±0.001328
• Length (nt): 36709

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00004215

Genomics

14 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C09D8.1k.1	C09D8.1k.1	6213	II: 10975539-11011782
Transcript:C09D8.1a.1	C09D8.1a.1	7008	II: 10975539-11012247
Transcript:C09D8.1l.1	C09D8.1l.1	6743	II: 10975539-11012240
Transcript:C09D8.1f.1	C09D8.1f.1	6615	II: 10975539-11011782
Transcript:C09D8.1i.1	C09D8.1i.1	6675	II: 10975569-11011782
Transcript:C09D8.1j.1	C09D8.1j.1	6747	II: 10975569-11011782
Transcript:C09D8.1e.1	C09D8.1e.1	6457	II: 10983030-11012241
Transcript:C09D8.1m.1	C09D8.1m.1	6199	II: 10983032-11012243
Transcript:C09D8.1d.1	C09D8.1d.1	6030	II: 10983070-11011782
Transcript:C09D8.1n.1	C09D8.1n.1	5628	II: 10983070-11011782
Transcript:C09D8.1b.1	C09D8.1b.1	4959	II: 10993507-11012247
Transcript:C09D8.1c.1	C09D8.1c.1	4114	II: 11002980-11012242
Transcript:C09D8.1g.1	C09D8.1g.1	4764	II: 11005699-11012244
Transcript:C09D8.1h.1	C09D8.1h.1	3252	II: 11007061-11011782

Other

14 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C09D8.1l	C09D8.1l	6285	II: 10975539-10975674
CDS:C09D8.1a	C09D8.1a	6543	II: 10975539-10975674
CDS:C09D8.1f	C09D8.1f	6615	II: 10975539-10975674
CDS:C09D8.1i	C09D8.1i	6675	II: 10975569-10975836
CDS:C09D8.1m	C09D8.1m	5700	II: 10983070-10983217
CDS:C09D8.1d	C09D8.1d	6030	II: 10983070-10983217
CDS:C09D8.1n	C09D8.1n	5628	II: 10983070-10983217
CDS:C09D8.1b	C09D8.1b	4404	II: 10993597-10993702
CDS:C09D8.1c	C09D8.1c	3651	II: 11002983-11003250
CDS:C09D8.1e	C09D8.1e	5958	II: 10983070-10983217
CDS:C09D8.1g	C09D8.1g	3744	II: 11006257-11006617
CDS:C09D8.1h	C09D8.1h	3252	II: 11007061-11007192
CDS:C09D8.1j	C09D8.1j	6747	II: 10975569-10975836
CDS:C09D8.1k	C09D8.1k	6213	II: 10975539-10975674

14 RNAi Result

• WBRNAi00068172
• WBRNAi00022983
• WBRNAi00000644
• WBRNAi00040183
• WBRNAi00111054
• WBRNAi00064606
• WBRNAi00010517
• WBRNAi00022278
• WBRNAi00109584
• WBRNAi00109195
• WBRNAi00111618
• WBRNAi00109293
• WBRNAi00109487
• WBRNAi00109390

556 Allele

• gk963801
• gk963053
• otn10894
• gk962682
• gk518813
• gk732926
• gk668189
• WBVar01895327
• ttTi9081
• gk630130
• gk676855
• gk346072
• WBVar01244419
• WBVar01895326
• gk154159
• WBVar01311269
• gk154158
• gk154157
• gk651694
• gk828337
• WBVar01895320
• WBVar02010060
• gk154139
• WBVar00243156
• gk154138
• gk561772
• gk737092
• gk154171
• gk806422
• WBVar02068235

1 Chromosome

• WormBase ID: II
• Organism: Caenorhabditis elegans
• Length (nt): 15279421

1 Chromosome Location

• Feature . Primary Identifier: WBGene00004215
• Start: 10975539
• End: 11012247
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrII_11012248..11012396
• Length (nt): 149
• Chromosome Location: II: 11012248-11012396
• Organism: Caenorhabditis elegans

193 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	Genes significantly enriched (> 2x, FDR < 5%) in a particular cell-type versus a reference sample of all cells at the same stage.	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:A-class-motor-neurons_larva_enriched
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L1-larva_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:AVE-neuron_L1-larva_expressed
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Transcripts that showed altered expression in cat-1(RNAi) animals comparing to control animals injected with empty vector.	p-value <= 0.05	WBPaper00066902:cat-1(RNAi)_regulated
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_developing
	Genes with expression level regulated by genotype (N2 vs CB4856) at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_regulated_developing
	Transcripts expressed in vulva.	FPKM >= 1.	WBPaper00064122:vulva_transcriptome
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Transcripts that showed significantly increased expression in mrg-1(qa6200) comparing to in control animals in primordial germ cells (PGCs) at L1 larva stage.	DESeq2(v1.32.0), FDR < 0.05.	WBPaper00064315:mrg-1(qa6200)_upregulated_PGCs
starvation 12 hours	Transcripts that showed significantly increased expression in dissected intestines of N2 L1 larva that were starved for 12 hours, comparing to fed animals.	EdgeR, FDR < 0.05, fold change >= 2.	WBPaper00067259:starvation_upregulated_intestine
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure.	Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2).	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:S.aureus-4h_upregulated_N2
Bacteria infection: Staphylococcus aureus	Transcripts that showed significantly decreased expression in animals experimentally colonised by a wild microbiota community and infected by the widespread animal pathogen, Staphylococcus aureus, comparing to animals colonized by microbiota but not infected by pathogen.	DeSeq2 (v. 1.42.0), Wald analyses testing against a null hypothesis of < |1.5|-fold change in gene expression between treatments (BenjaminiHochberg adjusted false detection rate of p <= 0.05.	WBPaper00067479:Microbiota-Pathogen_vs_Microbiota_downregulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:A-class-motor-neurons_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L2-larva_expressed

13 Expression Patterns

• Primary Identifier: Expr5215
• Remark: Strain: BC13391
• Reporter Gene: [ptp-3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCTTCGCTTTGTGTTTCGAGT] 3' and primer B 5' [TGAATTGGATGATGATGTTTTTCT] 3'.
• Pattern: Adult Expression: body wall muscle; Larval Expression: body wall muscle

• Primary Identifier: Expr1887
• Pattern: Antibody: The staining of anti-PTP-3 antisera in wild-type animals was weaker, but otherwise identical in pattern to the expression pattern of the PTP-3B::GFP transgenes. Reporter_gene: PTP-3B::GFP transgenes showed widespread expression in embryos. The earliest stage GFP was detected in these embryos was during late gastrulation (approximately 250-300 minutes after first cleavage at 20C). PTP-3B::GFP expression was observed uniformly on the surface of most, possibly all, cells in the embryo during gastrulation cleft closure and epidermal enclosure. In later embryos, larvae and adults PTP-3B::GFP expression became highest in the nervous system, including the nerve ring, dorsal cord, and ventral cord. Reporter_gene: The Pptp-3A::GFP construct expressed GFP from the comma stage (380 minutes) onwards in many neurons that also expressed PTP-3B::GFP. Thus, PTP-3 isoforms are expressed in many tissues during early development, and later become restricted to the nervous system and epithelial tissues.
• Subcellular Localization: PTP-3B::GFP was expressed in many but not all neurons, within which it was localized to neurites. In later embryos and larvae PTP-3B-GFP became localized within epidermal cells, apparently to adherens junctions.

• Primary Identifier: Expr13862
• Pattern: ptp-3bpro is expressed at low but detectable levels in many cells, including several amphid neurons, with highest expression in AWB and ASE.

• Primary Identifier: Expr1032072
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Chronogram758
• Remark: Original chronogram file: chronogram.1797.xml
• Reporter Gene: [C09D8.1:gfp] transcriptional fusion.

• Primary Identifier: Expr1144257
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2015150
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1025398
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2033388
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1940
• Remark: Possible reasons for no expression are: experimental error, low level or transient GFP expression, or these genes could be pseudogenes that are not expressed. Reporter gene fusion type not specified. The paper referred to C09D8.2, however, the sequence was merged to C09D8.1 according to WS83. --wjc
• Pattern: No observed GFP expression.

• Primary Identifier: Expr3649
• Subcellular Localization: PTP-3 was concentrated at the nerve ring and along the nerve cords in larval and adult animals and showed a punctate pattern. Along the nerve cord, PTP-3 was adjacent to but did not overlap UNC-49. Within the neurons, PTP-3 partially overlapped the SNT-1-containing domain but was concentrated at the edges of the SNT-1 staining. There was a precise colocalization of PTP-3 with SYD-2 and UNC-10. More specifically, a smaller punctum of PTP-3 was observed in or near the center of each of the larger SYD-2 puncta. These data indicate that PTP-3 is predominantly associated with the presynaptic density. To address whether PTP-3 localization was dependent on synaptic vesicles, the accumulation of SNT-1, PTP-3, and UNC-10 were analyzed in unc-104(e1265) kinesin mutants, which causes synaptic vesicles to be retained in cell bodies. PTP-3 and UNC-10 puncta showed colocalization in regions of the nerve cord lacking synaptic vesicles. Thus, like other presynaptic density components, PTP-3 appears to be trafficked to synapses independent of synaptic vesicles.

• Primary Identifier: Expr3650
• Subcellular Localization: PTP-3B::GFP showed a temporally regulated expression, with high expression throughout embryogenesis and larval development until the L1-L2 larval transition. In the adult nervous system, PTP-3B::GFP was present in the nerve ring and along axons of the ventral and dorsal nerve cords and was also observed in the pharyngeal epithelium and the developing uterus throughout development. Most of the PTP-3B::GFP was adjacent to the UNC-10 puncta, with only a small amount of GFP overlapping with UNC-10. PTP-3A::GFP expression was first detected around the 2-fold stage of embryonic development (450 min after fertilization) in the nerve ring and nerve cords and continued at a constant level through larval development. PTP-3A::GFP was seen in a punctate pattern along nerve processes and overlapped with UNC-10 in a pattern that was similar to the endogenous protein. These results suggest that PTP-3A is the major isoform that is localized to presynaptic domains. Consistent with this conclusion, in ptp-3A(ok244) mutant animals, <25% of the UNC-10 puncta (n = 200) contained any PTP-3, and the amount of PTP-3 present at those UNC-10 puncta was reduced.

• Primary Identifier: Expr15804
• Subcellular Localization: The PTP-3B/SYD-2 BiFC pair colocalizes with a synaptic vesicle marker SNB-1 in the nerve ring.

31 GO Annotation

21 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00004215
• Start: 10975539
• End: 11012247
• Strand: 1

31 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 36709

1 Sequence Ontology Term

• Name: gene

14 Strains

• WBStrain00031379
• WBStrain00032566
• WBStrain00050784
• WBStrain00002573
• WBStrain00005368
• WBStrain00005410
• WBStrain00005353
• WBStrain00005389
• WBStrain00004872
• WBStrain00005407
• WBStrain00005405
• WBStrain00005404
• WBStrain00005403
• WBStrain00005402

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrII_10975212..10975538
• Length (nt): 327
• Chromosome Location: II: 10975212-10975538
• Organism: Caenorhabditis elegans