WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00011240 Gene Name  mask-1
Sequence Name  ? R11A8.7 Brief Description  The protein product of this gene is predicted to contain a glutamine/asparagine (Q/N)-rich ('prion') domain, by the algorithm of Michelitsch and Weissman (as of the WS77 release of WormBase, i.e., in wormpep77).
Organism  Caenorhabditis elegans Automated Description  Predicted to enable RNA binding activity. Predicted to be located in cytoplasm. Expressed in head. Is an ortholog of human ANKHD1 (ankyrin repeat and KH domain containing 1); ANKHD1-EIF4EBP3 (ANKHD1-EIF4EBP3 readthrough); and ANKRD17 (ankyrin repeat domain 17).
Biotype  SO:0001217 Genetic Position  IV :4.57953±
Length (nt)  ? 12418
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00011240

Genomics

11 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:R11A8.7a.1 R11A8.7a.1 8484   IV: 10374901-10387318
Transcript:R11A8.7b.1 R11A8.7b.1 8416   IV: 10374903-10387318
Transcript:R11A8.7h.1 R11A8.7h.1 8423   IV: 10374905-10387309
Transcript:R11A8.7g.1 R11A8.7g.1 8417   IV: 10374908-10387318
Transcript:R11A8.7i.1 R11A8.7i.1 7815   IV: 10374946-10386742
Transcript:R11A8.7j.1 R11A8.7j.1 7809   IV: 10374946-10386742
Transcript:R11A8.7f.1 R11A8.7f.1 8441   IV: 10374946-10387314
Transcript:R11A8.7h.2 R11A8.7h.2 5101   IV: 10381441-10387308
Transcript:R11A8.7e.1 R11A8.7e.1 4452   IV: 10381518-10386742
Transcript:R11A8.7c.1 R11A8.7c.1 4218   IV: 10381885-10386742
Transcript:R11A8.7d.1 R11A8.7d.1 4284   IV: 10381885-10386742
 

Other

10 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:R11A8.7b R11A8.7b 7797   IV: 10374946-10375059
CDS:R11A8.7i R11A8.7i 7815   IV: 10374946-10375059
CDS:R11A8.7j R11A8.7j 7809   IV: 10374946-10375059
CDS:R11A8.7h R11A8.7h 4458   IV: 10381518-10381578
CDS:R11A8.7c R11A8.7c 4218   IV: 10381885-10382516
CDS:R11A8.7a R11A8.7a 7863   IV: 10374946-10375059
CDS:R11A8.7d R11A8.7d 4284   IV: 10381885-10382516
CDS:R11A8.7e R11A8.7e 4452   IV: 10381518-10381578
CDS:R11A8.7f R11A8.7f 7869   IV: 10374946-10375059
CDS:R11A8.7g R11A8.7g 7803   IV: 10374946-10375059

4 RNAi Result

WormBase ID
WBRNAi00002410
WBRNAi00051770
WBRNAi00051771
WBRNAi00017740

132 Allele

Public Name
gk964278
gk964078
gk964500
gk962765
WBVar01609465
WBVar02021119
WBVar01828129
h11519
cxTi9467
tm5136
ttTi25702
gk851678
gk443358
gk660491
gk684518
WBVar01453932
WBVar01453931
WBVar01453934
WBVar01453933
WBVar01856925
WBVar01581751
gk959002
WBVar01730669
WBVar01856929
WBVar01730670
WBVar01856928
WBVar01856927
WBVar01856926
WBVar01730671
WBVar01856931

1 Chromosome

WormBase ID Organism Length (nt)
IV Caenorhabditis elegans 17493829  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00011240 10374901 10387318 1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrIV_10387319..10387412   94 IV: 10387319-10387412 Caenorhabditis elegans

164 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:all-neurons_L1-larva_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. WBPaper00045420:fertilization_downregulated_transcript
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_Food
  Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. N.A. WBPaper00064071:NHR-49_interacting
  Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:arcade_intestinal-valve_expressed
  Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:body-muscle_expressed
  Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:GABAergic-neuron_expressed
  Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:hypodermis_expressed
  Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:intestine_expressed
  Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:NMDA-neuron_expressed
  Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:pharynx_expressed
  Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:seam_expressed
  Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-1-adult_vs_L4_upregulated_fem-3(q20)
  Transcripts that showed significantly increased expression in day 3 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-3-adult_vs_L4_upregulated_fem-3(q20)
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
  Maternal class (M): genes that are called present in at least one of the three PC6 replicates. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_M
  Transcripts that showed significantly increased expression in hrde-1(tm1200) animals, comparing to in N2, after growing at 25C for five generations (late generation). CuffDiff2 WBPaper00051265:F4_hrde-1(tm1200)_upregulated
  Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_SM
  Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals. Sleuth WBPaper00051558:aging_regulated
  Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage. DESeq WBPaper00053302:stavudine_24h_regulated
  Transcripts that showed significantly increased expression in sftb-1(cer6) deletion homozygous comparing to to in N2 animals at L4 larva stage. DESeq2, fold change > 2 WBPaper00058725:sftb-1(cer6)_downregulated
  Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:GABAergic-motor-neurons_L2-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:hypodermis_L3-L4-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:PVD-OLL-neurons_L3-L4-larva_expressed
  Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage. DESeq2, fold change > 2, FDR < 0.05. WBPaper00066594:ilc-17.1(syb5296)_upregulated
  Transcripts that showed significantly altered expression in rnp-6(dh1127) animals comparing to in N2 when fed with heat killed E. coli OP50. Differentially expressed genes (DEGs) (q-value <0.05) between different samples were identified using the stringtie version 1.3.0, followed by Cufflinks version 2.2. WBPaper00059824:rnp-6(dh1127)_regulated_OP50

8 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Also expressed in (comments from author) : Embryo and adult incomplete. To be updated. Strain: BC14319 [R11A8.7a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCAGTTTTTCTCATATTTGTTTCT] 3' and primer B 5' [TTTCTAATGGAATGAGGTGATTGA] 3'. Expr6503 Larval Expression: pharynx; intestine; rectal epithelium; developing vulva; hypodermis; seam cells; Nervous System; head neurons; amphid socket cells; neurons along body; unidentified cells in head;  
Also expressed in (comments from author) : unidentified cell in head, possibly an epithelial cell Strain: BC13429 [R11A8.7a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCAGTTTTTCTCATATTTGTTTCT] 3' and primer B 5' [TTTCTAATGGAATGAGGTGATTGA] 3'. Expr6504 Adult Expression: pharynx; intestine; Nervous System; pharyngeal neurons; unidentified cells in head; Larval Expression: pharynx; intestine; unidentified cells in head;  
Original chronogram file: chronogram.1836.xml [R11A8.7:gfp] transcriptional fusion. Chronogram795    
    Expr1155433 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr1016787 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr2023797 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr2005578 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1034935 Tiling arrays expression graphs  

9 GO Annotation

Annotation Extension Qualifier
  located_in
  located_in
  involved_in
  enables
  enables
  enables
  enables
  enables
  located_in

13 Homologues

Type
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00011240 10374901 10387318 1

9 Ontology Annotations

Annotation Extension Qualifier
  located_in
  located_in
  involved_in
  enables
  enables
  enables
  enables
  enables
  located_in

0 Regulates Expr Cluster

1 Sequence

Length
12418

1 Sequence Ontology Term

Identifier Name Description
gene  

2 Strains

WormBase ID
WBStrain00002587
WBStrain00002978

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrIV_10373823..10374900   1078 IV: 10373823-10374900 Caenorhabditis elegans