WormMine: Gene WBGene00006436

• WormBase Gene ID: WBGene00006436
• Gene Name: ttn-1
• Sequence Name: W06H8.8
• Brief Description: ttn-1, through multiple splicing, encodes at least six protein isoformsthat are orthologs of titin (OMIM:188840, mutated in cardiomyopathy ortibial muscular dystrophy), with the three largest isoforms being 2.2MDa, 1.2 MDa and 301 kDa; TTN-1 isoforms are expressed in body wall andvulval muscle, localized to the centers of I-bands, with the two largestisoforms expressed in all muscles except pharyngeal; the largest TTN-1isoform contains 56 Ig domains, 11 FnIII domains, a twitchin-likeprotein kinase domain, a domain similar to the elastic PEVK domain ofvertebrate titin, 96 tandem copies of a 16-residue motif predicted tocomprise a coiled-coil domain, and two other short multiply repeatedmotifs; the TTN-1 kinase domain is catalytically active, and itsactivity is quantitatively regulated by alternative splicing of anadjacent autoinhibitory domain; TTN-1 is mislocalized in analpha-actinin mutant (atn-1[ok84]); ttn-1 is transcribed from at leasttwo promoters, and its transcription is stimulated by NFI-1.
• Organism: Caenorhabditis elegans
• Automated Description: Enables actin filament binding activity and myosin binding activity. Predicted to be involved in axon guidance. Located in A band and I band. Expressed in muscle cell.
• Biotype: SO:0001217
• Genetic Position: V :-0.235725 ±0.011128
• Length (nt): 81724

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00006436

Genomics

15 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:W06H8.8a.1	W06H8.8a.1	45876	V: 6120909-6202626
Transcript:W06H8.8a.2	W06H8.8a.2	45903	V: 6121266-6202626
Transcript:W06H8.8f.1	W06H8.8f.1	45874	V: 6121270-6202533
Transcript:W06H8.8d.1	W06H8.8d.1	45757	V: 6121274-6202533
Transcript:W06H8.8k.1	W06H8.8k.1	23577	V: 6121577-6160654
Transcript:W06H8.8l.1	W06H8.8l.1	23532	V: 6121577-6160654
Transcript:W06H8.8g.1	W06H8.8g.1	44289	V: 6121577-6202533
Transcript:W06H8.8h.1	W06H8.8h.1	45522	V: 6121577-6202533
Transcript:W06H8.8i.1	W06H8.8i.1	44244	V: 6121577-6202533
Transcript:W06H8.8m.1	W06H8.8m.1	23493	V: 6121593-6160654
Transcript:W06H8.8n.1	W06H8.8n.1	23448	V: 6121593-6160654
Transcript:W06H8.8e.1	W06H8.8e.1	44160	V: 6121593-6202533
Transcript:W06H8.8b.1	W06H8.8b.1	44298	V: 6121593-6202626
Transcript:W06H8.8c.1	W06H8.8c.1	9968	V: 6190505-6202632
Transcript:W06H8.8j.1	W06H8.8j.1	8602	V: 6190581-6202620

Other

14 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:W06H8.8f	W06H8.8f	45567	V: 6121577-6121636
CDS:W06H8.8k	W06H8.8k	23577	V: 6121577-6121636
CDS:W06H8.8g	W06H8.8g	44289	V: 6121577-6121636
CDS:W06H8.8h	W06H8.8h	45522	V: 6121577-6121636
CDS:W06H8.8i	W06H8.8i	44244	V: 6121577-6121636
CDS:W06H8.8d	W06H8.8d	45438	V: 6121593-6121636
CDS:W06H8.8n	W06H8.8n	23448	V: 6121593-6121636
CDS:W06H8.8e	W06H8.8e	44160	V: 6121593-6121636
CDS:W06H8.8b	W06H8.8b	44205	V: 6121593-6121636
CDS:W06H8.8c	W06H8.8c	9648	V: 6190726-6191105
CDS:W06H8.8a	W06H8.8a	45483	V: 6121593-6121636
CDS:W06H8.8j	W06H8.8j	8370	V: 6190726-6191105
CDS:W06H8.8l	W06H8.8l	23532	V: 6121577-6121636
CDS:W06H8.8m	W06H8.8m	23493	V: 6121593-6121636

15 RNAi Result

• WBRNAi00000642
• WBRNAi00044447
• WBRNAi00044448
• WBRNAi00049307
• WBRNAi00054919
• WBRNAi00054924
• WBRNAi00055979
• WBRNAi00013166
• WBRNAi00013167
• WBRNAi00016202
• WBRNAi00019682
• WBRNAi00020251
• WBRNAi00080561
• WBRNAi00036825
• WBRNAi00092181

927 Allele

• gk963301
• gk963591
• gk963553
• gk963042
• gk963041
• gk964259
• gk964351
• gk963850
• gk963055
• tm11454
• WBVar01862508
• gk962696
• gk765468
• gk532314
• gk236611
• gk820187
• gk236604
• gk321939
• gk963056
• WBVar00210090
• gk236619
• gk687689
• gk468336
• gk937510
• WBVar00586528
• gk236731
• gk331079
• WBVar01588366
• WBVar01588367
• WBVar01588364

1 Chromosome

• WormBase ID: V
• Organism: Caenorhabditis elegans
• Length (nt): 20924180

1 Chromosome Location

• Feature . Primary Identifier: WBGene00006436
• Start: 6120909
• End: 6202632
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrV_6120207..6120908
• Length (nt): 702
• Chromosome Location: V: 6120207-6120908
• Organism: Caenorhabditis elegans

268 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:bodywall-muscle_L1-larva_expressed
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
	Genes that were upregulated in lin-15B(n744).	For each gene in each microarray hybridization experiment, the ratio of RNA levels from the two samples was transformed into a log2 value and the mean log2 ratio was calculated. The log2 ratios were normalized by print-tip Loess normalization (Dudoit and Yang, 2002). All genes with a false discovery rate of <= 5% (q <= 0.05) (Storey and Tibshirani, 2003) and a mean fold-change ratio of >= 1.5 were selected for further analysis.	WBPaper00038168:lin-15B(n744)_upregulated
Bacteria infection: Enterococcus faecalis	Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin_upregulated
	Coexpression clique No. 60, 176662_at-Y53F4B.16, on the genome-wide coexpression clique map for the nematode GPL200 platform.	All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform.	WBPaper00061527:176662_at-Y53F4B.16
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day5_vs_Day1_downregulated
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts that showed significantly decreased expression at 11-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day11_vs_Day1_downregulated
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_developing
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_regulated_developing
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
	Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_SM
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
	Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO.	Fold change > 2.	WBPaper00064306:Agaro-oligosaccharides_upregulated
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Genes that showed significantly increased expression in daf-2(e1370);hel-1(gk148684) comparing to in hel-1(gk148684)	To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs.	WBPaper00047131:daf-2(e1370)_upregulated_hel-1(gk148684)-background

8 Expression Patterns

• Primary Identifier: Expr2035713
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr6846
• Remark: Also expressed in (comments from author) : No comment. Strain: BC11654
• Reporter Gene: [W06H8.8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCTGAAATTTTAATGCAAATGCT] 3' and primer B 5' [GTTGCCCTCGATGTTTGTG] 3'.
• Pattern: Adult Expression: Reproductive System; vulval muscle; body wall muscle; Larval Expression: body wall muscle

• Primary Identifier: Expr2286
• Remark: Because the N-terminal 96 amino acid residues fused to GFP localizes to dense bodies, and because a major component of dense bodies is a-actinin, the localization of EU102 epitopes was determined in an alpha-actinin null mutant background. These animals, with the genotype atn-1(ok84), have normal motility and nearly normal muscle structure by polarized light microscopy. By EM, however, they have extra accumulations of actin near the ends of the muscle cells and, significantly, the dense bodies are shorter and more broadly based than normal. Staining of atn-1(ok84) muscle with EU102 is in a much broader pattern than wild-type and there is also loss of the "dashed" appearance. It is possible that in an alpha-actinin null background, the largest Ce titin isoforms are not properly anchored to the dense bodies. Sequence: Y38B5A.
• Pattern: Indirect immunofluorescence with EU102, demonstrates expression of the two largest isoforms in all muscles except for the pharynx. The pattern of expression and localization of Ce titin was examined in embryonic and larval muscles. During the 1.5 and 2-fold stages no specific staining was observed. Then, first appearing during the 2.5-fold stage, Ce titin appears in puncta which seem to follow the myofibril tracts. This punctate staining persists in the 3-fold stage, but then staining all but disappears in L1 larvae. However, during the L2 or L3 stages, and continuing during the remainder of development, Ce titin staining is localized in the same dashed pattern as seen in adult muscle.
• Subcellular Localization: As visualized with confocal immunofluorescence microscopy, EU102 stains the center of I-bands, between adjacent dense bodies. This was determined in three ways. When co-stained with antibodies to alpha-actinin, a major component of nematode dense bodies, EU102 staining appears to lie between, and does not overlap, the dense bodies. When co-stained with antibodies to actin, which gives a ladder-like pattern, EU102 appears to lie within the "rungs of the ladder". Finally, co-staining with antibodies to tropomyosin, that has been shown to localize to the outer portions of the I-bands in a linear pattern, showed that EU102 labels between the rows of tropomyosin staining. EU134 localizes to the I-band, but with a broader distribution than that obtained with EU102 antibodies. EU134 stains an area between dense bodies (overlapping with EU102 staining), as well as an area deeper into the I-band.

• Primary Identifier: Expr1032615
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr9017
• Remark: Picture: Fig 3.
• Subcellular Localization: Both EU143 and 9/10 antibodies broadly labeled the I-band, both between dense bodies and outside of dense bodies. EU143 and 9/10 also stained the outer edges of the A-band, as shown by partial colocalization of part of EU143 and 9/10 with either MHC B or twitchin. It indicates that the C-terminal TTN-1 epitopes reside throughout the I-band, except for dense bodies, and extend to the outer edge of the A-band.

• Primary Identifier: Chronogram625
• Remark: Original chronogram file: chronogram.1654.xml
• Reporter Gene: [W06H8.8:gfp] transcriptional fusion.

• Primary Identifier: Expr1158464
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2017574
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

21 GO Annotation

24 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00006436
• Start: 6120909
• End: 6202632
• Strand: -1

21 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 81724

1 Sequence Ontology Term