WormMine: Gene WBGene00006575

• WormBase Gene ID: WBGene00006575
• Gene Name: tir-1
• Sequence Name: F13B10.1
• Brief Description: tir-1 encodes a Toll-Interleukin 1 Receptor (TIR) domain adaptor protein that is the C. elegans ortholog of human SARM (sterile alpha and armadillo repeats); tir-1 is required for innate immunity, as loss of tir-1 activity results in increased susceptibility to infection; tir-1 also functions in a lateral signaling pathway that specifies neuronal identity and is required for proper localization of NSY-1/MAPKKK to post-synaptic regions; TIR-1 physically interacts with a number of proteins, including UNC-43/CaMKII, the RAB-1 GTPase, and the ATP synthase f subunit encoded by R53.4; TIR-1 is expressed in neurons and localizes to post-synaptic regions of axons.
• Organism: Caenorhabditis elegans
• Automated Description: Enables several functions, including NAD+ nucleosidase activity; enzyme binding activity; and identical protein binding activity. Involved in several processes, including NAD catabolic process; defense response to other organism; and regulation of gene expression. Acts upstream of or within serotonin biosynthetic process. Located in axon cytoplasm and cell body. Expressed in head. Used to study amyotrophic lateral sclerosis. Is an ortholog of human SARM1 (sterile alpha and TIR motif containing 1).
• Biotype: SO:0001217
• Genetic Position: III :-4.2469 ±0.000352
• Length (nt): 32053

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00006575

Genomics

13 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F13B10.1c.1	F13B10.1c.1	3661	III: 3869590-3887730
Transcript:F13B10.1e.3	F13B10.1e.3	3060	III: 3869590-3882006
Transcript:F13B10.1a.2	F13B10.1a.2	3498	III: 3869590-3891460
Transcript:F13B10.1a.1	F13B10.1a.1	3712	III: 3869590-3901642
Transcript:F13B10.1d.3	F13B10.1d.3	3669	III: 3869590-3873471
Transcript:F13B10.1b.1	F13B10.1b.1	2368	III: 3869591-3873511
Transcript:F13B10.1e.2	F13B10.1e.2	3394	III: 3869591-3882726
Transcript:F13B10.1e.1	F13B10.1e.1	3669	III: 3869591-3887730
Transcript:F13B10.1d.1	F13B10.1d.1	3684	III: 3869592-3901625
Transcript:F13B10.1d.2	F13B10.1d.2	3383	III: 3869593-3882726
Transcript:F13B10.1h.1	F13B10.1h.1	1041	III: 3870183-3871427
Transcript:F13B10.1f.1	F13B10.1f.1	2955	III: 3870183-3887608
Transcript:F13B10.1g.1	F13B10.1g.1	2784	III: 3870183-3891010

Other

8 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F13B10.1c	F13B10.1c	2946	III: 3870183-3870268
CDS:F13B10.1a	F13B10.1a	2793	III: 3870183-3870277
CDS:F13B10.1f	F13B10.1f	2955	III: 3870183-3870277
CDS:F13B10.1g	F13B10.1g	2784	III: 3870183-3870268
CDS:F13B10.1b	F13B10.1b	1761	III: 3870183-3870268
CDS:F13B10.1d	F13B10.1d	1032	III: 3870183-3870268
CDS:F13B10.1e	F13B10.1e	2406	III: 3870183-3870277
CDS:F13B10.1h	F13B10.1h	1041	III: 3870183-3870277

54 RNAi Result

• WBRNAi00112044
• WBRNAi00063698
• WBRNAi00068001
• WBRNAi00044472
• WBRNAi00073457
• WBRNAi00068809
• WBRNAi00013188
• WBRNAi00073459
• WBRNAi00073458
• WBRNAi00071903
• WBRNAi00005993
• WBRNAi00030869
• WBRNAi00071257
• WBRNAi00077209
• WBRNAi00077213
• WBRNAi00077226
• WBRNAi00077228
• WBRNAi00077227
• WBRNAi00077229
• WBRNAi00095256
• WBRNAi00068749
• WBRNAi00073460
• WBRNAi00072252
• WBRNAi00073455
• WBRNAi00073456
• WBRNAi00065513
• WBRNAi00073454
• WBRNAi00117981
• WBRNAi00087263
• WBRNAi00087264

424 Allele

• gk962532
• gk963881
• gk963882
• qd4
• qd2
• WBVar01262529
• WBVar01262532
• WBVar01262533
• WBVar01262537
• WBVar01262541
• WBVar01262542
• WBVar01262546
• WBVar01262547
• WBVar01262553
• WBVar01262554
• WBVar01262551
• WBVar02069583
• WBVar01606988
• qd66
• qd67
• WBVar01656376
• WBVar01656375
• WBVar01656374
• h7403
• h4260
• h15430
• h5418
• h12108
• h5535
• gk954007

1 Chromosome

• WormBase ID: III
• Organism: Caenorhabditis elegans
• Length (nt): 13783801

1 Chromosome Location

• Feature . Primary Identifier: WBGene00006575
• Start: 3869590
• End: 3901642
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrIII_3869588..3869589
• Length (nt): 2
• Chromosome Location: III: 3869588-3869589
• Organism: Caenorhabditis elegans

281 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Genes with expression altered >= 3-fold in dpy-10(e128) mutants.	Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)).	WBPaper00035873:dpy-10_regulated
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
	Transcripts that showed significantly increased expression in csr-1a(tor159) comparing to in N2 at 25C.	DESeq2, fold change > 2, p-value < 0.05.	WBPaper00061753:csr-1(tor159)_upregulated_25C
Bacteria: E.faecalis strain OG1RF	Transcripts that showed significantly increased expression after infection by E. faecalis OG1RF.	Ballgown was used to calculate differential expression of genes using FPKM data and to generate tables with fold change and P values. Genes were shortlisted with a cutoff of 2-fold change and P values of less than 0.05.	WBPaper00059754:E.faecalis_OG1RF_upregulated
	Genes that were upregulated in lin-15B(n744).	For each gene in each microarray hybridization experiment, the ratio of RNA levels from the two samples was transformed into a log2 value and the mean log2 ratio was calculated. The log2 ratios were normalized by print-tip Loess normalization (Dudoit and Yang, 2002). All genes with a false discovery rate of <= 5% (q <= 0.05) (Storey and Tibshirani, 2003) and a mean fold-change ratio of >= 1.5 were selected for further analysis.	WBPaper00038168:lin-15B(n744)_upregulated
Bacteria infection: Enterococcus faecalis	Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Allantoin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin_upregulated
	Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc).	DESeq2, fold change >= 2, FDR <= 0.01.	WBPaper00056826:SGP_biased
	Transcripts that showed significantly increased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Psora-Allantoin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Metformin_upregulated
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage.	edgeR, fold change > 2, FDR < 0.05	WBPaper00060909:atfs-1(cmh15)_downregulated
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at old adults stage (214 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_aging
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_developing
	Genes with expression level regulated by genotype (N2 vs CB4856) at old adults stage (214 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_regulated_aging
	Genes with expression level regulated by genotype (N2 vs CB4856) at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_regulated_developing
	Genes with expression level regulated by genotype (N2 vs CB4856) at Late reproduction stage (96 hours at 24 centigrade).	Authors permuted transcript values and used a genome-wide threshold of log10 P-value = 2, which resembles a false discovery rate (FDR) of 0.0118.	WBPaper00040858:eQTL_regulated_reproductive
	Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO.	Fold change > 2.	WBPaper00064306:Agaro-oligosaccharides_upregulated
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Transcripts that showed significantly increased expression in mrg-1(qa6200) comparing to in control animals in primordial germ cells (PGCs) at L1 larva stage.	DESeq2(v1.32.0), FDR < 0.05.	WBPaper00064315:mrg-1(qa6200)_upregulated_PGCs

9 Expression Patterns

• Primary Identifier: Expr2035549
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr5747
• Remark: Also expressed in (comments from author) : No comments. Strain: BC11466
• Reporter Gene: [tir-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCGCTGAATAAGATTGGGG] 3' and primer B 5' [ACAGATTCAGAGGTGGGGACT] 3'.
• Pattern: Adult Expression: pharynx; intestine; unidentified cells in head; Larval Expression: pharynx; intestine; unidentified cells in head

• Primary Identifier: Expr14886
• Pattern: To determine where tir-1 was expressed, we used CRISPR-Cas9-based gene editing to generate a tir-1::GFP reporter. We observed TIR-1::GFP expression in AWC olfactory neurons.

• Primary Identifier: Expr3964
• Subcellular Localization: An anti-TIR-1 antibody was able to detect protein in whole-mount immunostaining of animals that expressed odr-3::tir-1 or F13B10.1 rescuing transgenes, although the endogenous expression of TIR-1 was undetectable. Staining revealed punctate expression in the nerve ring, the region where AWC axons reside.

• Primary Identifier: Expr1032710
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr1025922
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2017410
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1148422
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr3965
• Remark: A similar punctate localization pattern of TIR-1 was present in animals bearing a rescuing odr-3::tir-1::DsRed transgene. Both TIR-1::GFP and TIF-1::RFP can restore wild-type tir-1 function. With the qualification that they were obtained with overexpressed or tagged proteins, these results suggest that TIR-1 protein is localized to a subcompartment in AWC axons. To ask whether TIR-1 is localized to presynaptic or post-synaptic sites in the AWC axon, the odr-3::tir-1::DsRed transgene was coexpressed with str-2::synaptobrevin (snb-1)::GFP, a GFP-tagged synaptic vesicle protein that serves as a presynaptic marker, or odr-3::lin-10::YFP, a YFP-tagged PDZ-domain protein that localizes to post-synaptic densities in C. elegans neurons. TIR-1::DsRed was strikingly colocalized with LIN-10::YFP, but was usually adjacent to SNB-1::GFP rather than overlapping with it, despite the greater overall expression of SNB-1::GFP. These results suggest that TIR-1 may be localized to post-synaptic regions of AWC.
• Subcellular Localization: TIR-1::GFP was localized in a punctate pattern along the AWC axon, and mostly excluded from the cell body and dendrites, like TIR-1 detected by the antiserum.

39 GO Annotation

5 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00006575
• Start: 3869590
• End: 3901642
• Strand: -1

39 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 32053

1 Sequence Ontology Term

• Name: gene

7 Strains

• WBStrain00021984
• WBStrain00021983
• WBStrain00031789
• WBStrain00032827
• WBStrain00035844
• WBStrain00040806
• WBStrain00005265

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrIII_3901643..3903184
• Length (nt): 1542
• Chromosome Location: III: 3901643-3903184
• Organism: Caenorhabditis elegans