WormMine: Gene WBGene00006820

• WormBase Gene ID: WBGene00006820
• Gene Name: unc-89
• Sequence Name: C09D1.1
• Brief Description: unc-89 encodes several protein isoforms variably characterized by the presence or absence of SH3, DH, PH, immunoglobulin and myosin light chain kinase (MLCK)-like protein kinase domains; during development, unc-89 is required for proper organization of A bands in striated muscle and thus for fully normal locomotion, pharyngeal muscle contractions, and body size; unc-89 is expressed in body wall muscle, pharyngeal muscle and some cells in the tail; UNC-89 protein isoforms localize to the middle of A-bands, consistent with UNC-89 being an M line component; UNC-89 interacts with the SCPL-1 phosphatase both in vitro and in vivo.
• Organism: Caenorhabditis elegans
• Automated Description: Enables MATH domain binding activity; enzyme binding activity; and guanyl-nucleotide exchange factor activity. Involved in several processes, including myofibril assembly; nematode pharyngeal gland morphogenesis; and regulation of striated muscle contraction. Located in M band. Expressed in alimentary muscle; gonad; tail; and vulval muscle. Human ortholog(s) of this gene implicated in centronuclear myopathy 5. Is an ortholog of human SPEG (striated muscle enriched protein kinase).
• Biotype: SO:0001217
• Genetic Position: I :-1.73264 ±0.009136
• Length (nt): 55184

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00006820

Genomics

16 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C09D1.1a.1	C09D1.1a.1	20769	I: 4035702-4078806
Transcript:C09D1.1e.1	C09D1.1e.1	17979	I: 4035893-4078127
Transcript:C09D1.1l.1	C09D1.1l.1	19833	I: 4035893-4078127
Transcript:C09D1.1o.1	C09D1.1o.1	17739	I: 4035893-4078127
Transcript:C09D1.1f.1	C09D1.1f.1	22326	I: 4035893-4090427
Transcript:C09D1.1k.1	C09D1.1k.1	24180	I: 4035893-4090427
Transcript:C09D1.1m.1	C09D1.1m.1	22527	I: 4035893-4090427
Transcript:C09D1.1n.1	C09D1.1n.1	22086	I: 4035893-4090427
Transcript:C09D1.1b.1	C09D1.1b.1	24703	I: 4035893-4090884
Transcript:C09D1.1g.1	C09D1.1g.1	22827	I: 4047136-4090427
Transcript:C09D1.1h.1	C09D1.1h.1	21108	I: 4047136-4090427
Transcript:C09D1.1i.1	C09D1.1i.1	22761	I: 4047136-4090427
Transcript:C09D1.1j.1	C09D1.1j.1	20907	I: 4047136-4090427
Transcript:C09D1.1p.1	C09D1.1p.1	20667	I: 4047136-4090427
Transcript:C09D1.1d.1	C09D1.1d.1	4784	I: 4080539-4090885
Transcript:C09D1.1c.1	C09D1.1c.1	4734	I: 4081507-4090884

Other

16 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C09D1.1a	C09D1.1a	19899	I: 4035893-4035942
CDS:C09D1.1e	C09D1.1e	17979	I: 4035893-4035942
CDS:C09D1.1l	C09D1.1l	19833	I: 4035893-4035942
CDS:C09D1.1f	C09D1.1f	22326	I: 4035893-4035942
CDS:C09D1.1k	C09D1.1k	24180	I: 4035893-4035942
CDS:C09D1.1g	C09D1.1g	22827	I: 4047136-4047214
CDS:C09D1.1h	C09D1.1h	21108	I: 4047136-4047214
CDS:C09D1.1p	C09D1.1p	20667	I: 4047136-4047214
CDS:C09D1.1b	C09D1.1b	24246	I: 4035893-4035942
CDS:C09D1.1c	C09D1.1c	4182	I: 4081602-4081624
CDS:C09D1.1d	C09D1.1d	4191	I: 4080674-4080705
CDS:C09D1.1i	C09D1.1i	22761	I: 4047136-4047214
CDS:C09D1.1j	C09D1.1j	20907	I: 4047136-4047214
CDS:C09D1.1m	C09D1.1m	22527	I: 4035893-4035942
CDS:C09D1.1n	C09D1.1n	22086	I: 4035893-4035942
CDS:C09D1.1o	C09D1.1o	17739	I: 4035893-4035942

25 RNAi Result

• WBRNAi00089761
• WBRNAi00001401
• WBRNAi00040173
• WBRNAi00041110
• WBRNAi00066750
• WBRNAi00002917
• WBRNAi00038531
• WBRNAi00038533
• WBRNAi00038530
• WBRNAi00022291
• WBRNAi00076104
• WBRNAi00029157
• WBRNAi00038532
• WBRNAi00081076
• WBRNAi00066564
• WBRNAi00089943
• WBRNAi00090103
• WBRNAi00090261
• WBRNAi00091677
• WBRNAi00091692
• WBRNAi00091707
• WBRNAi00091722
• WBRNAi00091737
• WBRNAi00091752
• WBRNAi00091773

812 Allele

• gk962706
• gk963902
• gk964159
• otn9299
• otn9300
• WBVar00243152
• WBVar01431288
• WBVar01431290
• WBVar01431292
• WBVar01431291
• WBVar01431283
• WBVar01431281
• WBVar01694749
• st79
• st85
• st515
• su75
• su227
• su240
• tm752
• gk763030
• gk841461
• gk584872
• gk641189
• gk766935
• gk810593
• gk930752
• gk491378
• gk466428
• gk924127

1 Chromosome

• WormBase ID: I
• Organism: Caenorhabditis elegans
• Length (nt): 15072434

1 Chromosome Location

• Feature . Primary Identifier: WBGene00006820
• Start: 4035702
• End: 4090885
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrI_4090886..4094159
• Length (nt): 3274
• Chromosome Location: I: 4090886-4094159
• Organism: Caenorhabditis elegans

233 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Genes with expression altered >= 3-fold in dpy-10(e128) mutants.	Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)).	WBPaper00035873:dpy-10_regulated
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_upregulated
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day5_vs_Day1_downregulated
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts that showed significantly decreased expression at 11-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day11_vs_Day1_downregulated
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at old adults stage (214 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_aging
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
	Transcripts expressed in vulva.	FPKM >= 1.	WBPaper00064122:vulva_transcriptome
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
	Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO.	Fold change > 2.	WBPaper00064306:Agaro-oligosaccharides_upregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
Dietary restriction	Transcripts that showed significantly decreased expression after N2 animals were under dietary restriction (DR, OP50 OD = 0.1) from 3-day post L4 till 6-day post L4 adult hermaphrodite stage, comparing to under ad libtum (AL, OP50 OD = 3) condition.	Bioconductor package edgeR, p < 0.05.	WBPaper00056443:DietaryRestriction_downregulated
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Genes that showed significantly increased expression in daf-2(e1370);hel-1(gk148684) comparing to in hel-1(gk148684)	To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs.	WBPaper00047131:daf-2(e1370)_upregulated_hel-1(gk148684)-background

15 Expression Patterns

• Primary Identifier: Expr4551
• Pattern: Expression of major cytoskeletal proteins were detected in the myoepithelial sheath, and, interestingly, some of them were also expressed in other parts of the somatic gonad.

• Primary Identifier: Expr5331
• Remark: Strain: BC12115
• Reporter Gene: [C24G7.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACACTACCCGTTTGCTCAATTT] 3' and primer B 5' [ATGAGCTTCTTCTCTTAGCTTTGC] 3'.
• Pattern: Adult Expression: body wall muscle; unidentified cells; Larval Expression: body wall muscle; unidentified cells

• Primary Identifier: Expr5907
• Remark: Strain: BC12402
• Reporter Gene: [F28F5.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATAAAAACTGGCGCACCTATTAAG] 3' and primer B 5' [TTGTGGATTATACGGCGGA] 3'.
• Pattern: Adult Expression: pharynx; Larval Expression: pharynx; unidentified cells in tail

• Primary Identifier: Expr8742
• Remark: No detailed description on expression pattern in other tissue or life stages.. Picture: N.A.
• Pattern: Not expressed in gonad.

• Primary Identifier: Expr2036053
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr8552
• Remark: Picture: Figure 6.
• Subcellular Localization: Co-localization of LIM-9 and the interkinase region of UNC-89 was observed at the M lines in C. elegans body wall muscle.

• Primary Identifier: Expr1032885
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr3083
• Pattern: unc-89-A and -B are expressed in body-wall, pharyngeal and vulval muscles, unc-89-C is expressed in body-wall and vulval muscles (but not in the pharynx), and unc-89-D is expressed in only a few cells: vulval, intestinal, anal depressor and anal sphincter muscles. The identity of the anal depressor muscle was verified by examining expression of unc-89-D::GFP in adult males, which are known not to contain this muscle. Although all three promoters direct expression in vulval muscles, only the promoter for unc-89-D drives expression in the enteric muscles.

• Primary Identifier: Expr1559
• Pattern: Both antibodies localize to the pharyngeal muscle.
• Subcellular Localization: UNC-89 protein localize to the middle of A band in muscle cells.

• Primary Identifier: Expr1021855
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Chronogram315
• Remark: Original chronogram file: chronogram.1335.xml
• Reporter Gene: [F28F5.4:gfp] transcriptional fusion.

• Primary Identifier: Chronogram312
• Remark: Original chronogram file: chronogram.1332.xml
• Reporter Gene: [C09D1.1:gfp] transcriptional fusion.

• Primary Identifier: Expr1144248
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2017917
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr11966
• Subcellular Localization: In wild-type embryos, UNC-89 is present in nascent M lines.

35 GO Annotation

38 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00006820
• Start: 4035702
• End: 4090885
• Strand: 1

35 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 55184

1 Sequence Ontology Term