WormMine: Gene WBGene00006412

• WormBase Gene ID: WBGene00006412
• Gene Name: nlg-1
• Sequence Name: C40C9.5
• Brief Description: nlg-1 encodes the sole C. elegans neuroligin homolog; nlg-1 activity is required for a subset of sensory behaviors and sensory processing, and for normal sensitivity to oxidative stress and mercury compounds; NLG-1 is expressed in a variety of neurons, including sensory, motor, and interneurons, and localizes to synaptic regions.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable neurexin family protein binding activity and signaling receptor activity. Involved in gamma-aminobutyric acid receptor clustering and negative regulation of neurotransmitter secretion. Located in axon; dendrite; and synapse. Expressed in several structures, including body wall musculature; diagonal muscle; neurons; tail; and ventral nerve cord. Used to study autism spectrum disorder. Human ortholog(s) of this gene implicated in autistic disorder. Is an ortholog of human NLGN4Y (neuroligin 4 Y-linked).
• Biotype: SO:0001217
• Genetic Position: X :13.9949 ±0.030126
• Length (nt): 5800

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00006412

Genomics

9 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C40C9.5b.1	C40C9.5b.1	2776	X: 13625373-13631166
Transcript:C40C9.5a.1	C40C9.5a.1	2739	X: 13625419-13631166
Transcript:C40C9.5d.1	C40C9.5d.1	2626	X: 13625433-13631172
Transcript:C40C9.5h.1	C40C9.5h.1	1269	X: 13625690-13628958
Transcript:C40C9.5i.1	C40C9.5i.1	1278	X: 13625690-13628958
Transcript:C40C9.5e.1	C40C9.5e.1	2544	X: 13625690-13631095
Transcript:C40C9.5f.1	C40C9.5f.1	2397	X: 13625690-13631095
Transcript:C40C9.5g.1	C40C9.5g.1	2406	X: 13625690-13631095
Transcript:C40C9.5c.1	C40C9.5c.1	2854	X: 13626149-13631095

Other

9 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C40C9.5f	C40C9.5f	2397	X: 13625690-13625735
CDS:C40C9.5c	C40C9.5c	2385	X: 13626618-13626761
CDS:C40C9.5a	C40C9.5a	2397	X: 13625690-13625744
CDS:C40C9.5b	C40C9.5b	2388	X: 13625690-13625735
CDS:C40C9.5d	C40C9.5d	2292	X: 13625690-13625744
CDS:C40C9.5e	C40C9.5e	2544	X: 13625690-13625744
CDS:C40C9.5g	C40C9.5g	2406	X: 13625690-13625744
CDS:C40C9.5h	C40C9.5h	1269	X: 13625690-13625735
CDS:C40C9.5i	C40C9.5i	1278	X: 13625690-13625744

6 RNAi Result

• WBRNAi00042252
• WBRNAi00011813
• WBRNAi00029704
• WBRNAi00080989
• WBRNAi00080990
• WBRNAi00111983

111 Allele

• gk964260
• gk964029
• gk962707
• gk964028
• gk963810
• gk963581
• WBVar01759994
• WBVar01759993
• WBVar01602391
• WBVar01602390
• gk299126
• gk299127
• gk299128
• gk299133
• gk299134
• gk299135
• gk299136
• gk299129
• gk299130
• gk299131
• gk299132
• gk299137
• gk299138
• gk299139
• gk299140
• gk299141
• tm474
• WBVar01544653
• WBVar01544652
• WBVar01544651

1 Chromosome

• WormBase ID: X
• Organism: Caenorhabditis elegans
• Length (nt): 17718942

1 Chromosome Location

• Feature . Primary Identifier: WBGene00006412
• Start: 13625373
• End: 13631172
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrX_13621729..13625372
• Length (nt): 3644
• Chromosome Location: X: 13621729-13625372
• Organism: Caenorhabditis elegans

174 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L1-larva_expressed
	Single-cell RNA-Seq cell group 84_0 expressed in neuron.	scVI 0.6.0	WBPaper00065841:84_0
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:AVE-neuron_L1-larva_expressed
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:bodywall-muscle_L1-larva_expressed
Bacteria: E.faecalis strain OG1RF	Transcripts that showed significantly increased expression after infection by E. faecalis OG1RF.	Ballgown was used to calculate differential expression of genes using FPKM data and to generate tables with fold change and P values. Genes were shortlisted with a cutoff of 2-fold change and P values of less than 0.05.	WBPaper00059754:E.faecalis_OG1RF_upregulated
Bacteria infection: Enterococcus faecalis	Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day5_vs_Day1_downregulated
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
	Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO.	Fold change > 2.	WBPaper00064306:Agaro-oligosaccharides_upregulated
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure.	Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2).	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:S.aureus-4h_upregulated_N2
	Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_SM
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts that showed significantly increased expression in sftb-1(cer6) deletion homozygous comparing to to in N2 animals at L4 larva stage.	DESeq2, fold change > 2	WBPaper00058725:sftb-1(cer6)_downregulated
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
	Transcripts that showed significantly increased expression in xrep-4(lax137).	DESeq2. Genes were selected if their p value < 0.01.	WBPaper00066062:xrep-4(lax137)_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:A-class-motor-neurons_L2-larva_expressed

20 Expression Patterns

• Primary Identifier: Expr5479
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC13535
• Reporter Gene: [C40C9.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGGGAAAAGAAAATGGGATACTT] 3' and primer B 5' [CATGCCTGTTCACTTCCAAAT] 3'.
• Pattern: Adult Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; unidentified cells in tail ; Larval Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; unidentified cells in tail

• Primary Identifier: Expr5478
• Remark: Also expressed in (comments from author) : few head neurons Strain: BC13247
• Reporter Gene: [C40C9.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGGGAAAAGAAAATGGGATACTT] 3' and primer B 5' [CATGCCTGTTCACTTCCAAAT] 3'.
• Pattern: Adult Expression: Nervous System; head neurons; Larval Expression: Nervous System; ventral nerve cord; head neurons

• Primary Identifier: Expr9444
• Pattern: nlg-1 is expressed in a subset of neurons in C. elegans adults, including ~20 cells in the ventral nerve cord and ~20 cells in the head. The nlg-1-expressing cells in the ventral nerve cord were identified as the cholinergic VA and DA motor neurons. Authors also identified the two AIY and two URB interneurons and the four URA motor neurons in the head, and the two PVD mechanosensory and two HSN motor neurons in the body, as nlg-1-expressing cells. Finally, faint Pnlg-1::YFP expression was also observed in body wall muscles.
• Subcellular Localization: Bright punctate staining was observed in dendritic (postsynaptic) regions. Clear punctate staining was also observed in presynaptic regions of each neuronal type. For example, in the DA9 motor neuron, bright NLG-1::YFP puncta were present in the ventral postsynaptic domain, and dimmer puncta were present in the dorsal presynaptic region. Puncta were excluded from the synapse-poor region between the cell body and dorsal presynaptic region and from the anterior asynaptic region of the dorsal process. To further study the punctate staining in the presynaptic region, NLG-1::YFP localization was examined in animals expressing the tagged synaptic vesicle protein mCherry::RAB-3 in DA9. In the dorsal axon, NLG-1::YFP puncta partially colocalized with puncta containing mCherry::RAB-3, suggesting that NLG-1::YFP localization is perisynaptic. Sub-cellular localization within the body wall muscle: Muscle cell membrane +/- Muscle arms

• Primary Identifier: Expr7951
• Remark: Picture: Figure 2.
• Subcellular Localization: Bright punctate staining was observed in dendritic (postsynaptic) regions. Clear punctate staining was also observed in presynaptic regions of each neuronal type. For example, in the DA9 motor neuron, bright NLG-1::YFP puncta were present in the ventral postsynaptic domain, and dimmer puncta were present in the dorsal presynaptic region. Puncta were excluded from the synapse-poor region between the cell body and dorsal presynaptic region and from the anterior asynaptic region of the dorsal process. To further study the punctate staining in the presynaptic region, NLG-1::YFP localization was examined in animals expressing the tagged synaptic vesicle protein mCherry::RAB-3 in DA9. In the dorsal axon, NLG-1::YFP puncta partially colocalized with puncta containing mCherry::RAB-3, suggesting that NLG-1::YFP localization is perisynaptic.

• Primary Identifier: Expr14246
• Pattern: We dissected and isolated pharynxes from two nlg-1 transcriptional reporter strains and established that there is no nlg-1 expression in the pharynx or in its associated microcircuit. We found no co-expression of neuroligin in ADF and no expression in major sensory neuron classes, using specific markers for the following neurons: ASJ, AWB, AWC and ASE neurons. However, although neuroligin is not expressed in NSM we found expression in HSN neurons in the vulva area. Finally, to further investigate expression in a subset of sensory neurons we tried to identify neuroligin expression in the DiI labelled amphid neurons: ADL, ASH, ASI, ASJ, ASK, AWB: Again we found no neuroligin expression. However, nlg-1 is expressed in a subset of eat-4 glutamatergic neuron classes. In addition, neuroligin expression was localized specifically in a subset of dopaminergic sensory neurons, ADEs, which also are involved in food-dependent behaviours (Hills, Brockie et al. 2004), as well as in the bilateral interneurons AIY, that function to extend food-seeking periods (Shtonda and Avery 2006). Finally, by positional identification of cell bodies we found expression of nlg-1 in the sensory neurons ALA and URX, as well as the interneuron AVJ.

• Primary Identifier: Expr8891
• Remark: Picture: Fig. 3.
• Pattern: nlg-1 is expressed in a subset of neurons in C. elegans adults, including ~20 cells in the ventral nerve cord and ~20 cells in the head (Fig. 3). The nlg-1-expressing cells in the ventral nerve cord were identified as the cholinergic VA and DA motor neurons. Authors also identified the two AIY and two URB interneurons and the four URA motor neurons in the head, and the two PVD mechanosensory and two HSN motor neurons in the body, as nlg-1-expressing cells. Finally, faint Pnlg-1::YFP expression was also observed in body wall muscles.

• Primary Identifier: Expr8892
• Remark: Picture: Fig. 4.
• Subcellular Localization: Confocal microscopy revealed that NLG-1::YFP is present at or near synapses; localization in the synapse-rich nerve ring and ventral nerve cord is observed in embryos, and persists throughout development. NLG-1::YFP was also present in some neuronal cell bodies (such cells also express the FRM77 Pnlg-1::YFP transcriptional reporter); this may reflect modest overexpression of the NLG-1::YFP transgene. NLG-1::YFP-containing puncta were observed along the sublateral nerve cords; these are of necessity muscle-derived, and therefore postsynaptic. Furthermore, these NLG-1::YFP puncta were apposed to presynaptic active zones (UNC-10/RIM-containing puncta) present in the axons. Thus, at least in some cells, NLG-1::YFP is localized to postsynaptic regions.

• Primary Identifier: Expr1032602
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr14745
• Pattern: NLG-1 expressed under its own promoter was localized in a punctate pattern in numerous neurons and muscles of the male tail.

• Primary Identifier: Expr12333

• Primary Identifier: Expr12363
• Subcellular Localization: NLG-1-RFP formed clusters exclusively detected at GABAergic synapses.

• Primary Identifier: Expr12276
• Pattern: nlg-1 is expressed early in the development of C. elegans. neuroligin expressing cells were detected in the comma stage of the embryo when neurogenesis is beginning. This initial expression is sustained during the first phase of embryogenesis in neurons in the head ganglia and is clearly present in ventral nerve cord neurons during the proliferation phases in L1 and L2 stages. The expression in L4 and adult stages was marked by fluorescence in the head region and ventral cord and is consistent with nlg-1 contributing its function during later development.

• Primary Identifier: Chronogram738
• Remark: Original chronogram file: chronogram.1775.xml
• Reporter Gene: [C40C9.5:gfp] transcriptional fusion.

• Primary Identifier: Expr10537
• Reporter Gene: The transcriptional reporter for nlg-1 used 6.5kb of 5' flanking sequence. A 2.4kb myo-3 myosin promoter was used for expression in body muscles, a 3.2kb unc-17 VAChT promoter was used for expression in cholinergic neurons, and a 2.6kb unc-129 promoter was used for expression in DA and DB motor neurons.
• Pattern: The nlg-1 promoter expressed GFP in cholinergic motor neurons but not in GABAergic neurons.
• Subcellular Localization: When expressed in cholinergic DA and DB motor neurons, NLG-1::GFP exhibited a punctate distribution in dorsal cord axons but was diffuse in ventral cord dendrites. Dorsal cord NLG-1 puncta co-localized with a synaptic vesicle (SV) marker (mCherry-tagged UNC-57 endophilin). NRX-1::GFP expressed in body muscles was also punctate in the nerve cords and these NRX-1 puncta were often closely apposed to pre-synaptic UNC-57 puncta.

• Primary Identifier: Expr2014273
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1146243
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr1013445
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr11981
• Subcellular Localization: In C. elegans, NLG-1 is specifically localized to the postsynaptic sites of inhibitory synapses (G. Maro and K. S., unpublished data). NLG-1::GFP expressed in the body wall muscles exists as puncta that are closely juxtaposed to the presynaptic puncta in the DD-type inhibitory motor neurons.

• Primary Identifier: Expr2032513
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Chronogram1429
• Remark: Original chronogram file: chronogram.308.xml
• Reporter Gene: [C40C9.5:gfp] transcriptional fusion.

26 GO Annotation

27 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00006412
• Start: 13625373
• End: 13631172
• Strand: -1

26 Ontology Annotations

4 Regulates Expr Cluster

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Genes that showed significantly increased expression in nrx-1(tm1961);nlg-1(ok259) mutants comparing to in N2.	Seqsolve uses Cufflinks/Cuffdiff to quantify and identify transcripts with a significant level of expression between different conditions. p-value < 0,005.	WBPaper00053023:nrx-1(tm1961);nlg-1(ok259)_upregulated
	Genes that showed significantly decreased expression in nlg-1(ok259) mutants comparing to in N2.	Seqsolve uses Cufflinks/Cuffdiff to quantify and identify transcripts with a significant level of expression between different conditions. p-value < 0,005.	WBPaper00053023:nlg-1(ok259)_downregulated
	Genes that showed significantly increased expression in nlg-1(ok259) mutants comparing to in N2.	Seqsolve uses Cufflinks/Cuffdiff to quantify and identify transcripts with a significant level of expression between different conditions. p-value < 0,005.	WBPaper00053023:nlg-1(ok259)_upregulated
	Genes that showed significantly decreased expression in nrx-1(tm1961);nlg-1(ok259) mutants comparing to in N2.	Seqsolve uses Cufflinks/Cuffdiff to quantify and identify transcripts with a significant level of expression between different conditions. p-value < 0,005.	WBPaper00053023:nrx-1(tm1961);nlg-1(ok259)_downregulated

1 Sequence

• Length: 5800

1 Sequence Ontology Term

• Name: gene

6 Strains

• WBStrain00035599
• WBStrain00002633
• WBStrain00007561
• WBStrain00005130
• WBStrain00002517
• WBStrain00005129

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrX_13631173..13632263
• Length (nt): 1091
• Chromosome Location: X: 13631173-13632263
• Organism: Caenorhabditis elegans