Genomics
7 Transcripts
| Class | WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|---|
| MRNA | Transcript:Y55D5A.5a.1 | Y55D5A.5a.1 |
7044
 |
III: 2994514-3028800 |
| MRNA | Transcript:Y55D5A.5c.1 | Y55D5A.5c.1 |
7325
|
III: 2994544-3040846 |
| MRNA | Transcript:Y55D5A.5g.1 | Y55D5A.5g.1 |
2019
|
III: 2995919-3001312 |
| MRNA | Transcript:Y55D5A.5f.1 | Y55D5A.5f.1 |
3111
|
III: 2995919-3010468 |
| MRNA | Transcript:Y55D5A.5e.1 | Y55D5A.5e.1 |
5313
|
III: 2995919-3019606 |
| MRNA | Transcript:Y55D5A.5d.1 | Y55D5A.5d.1 |
5400
|
III: 2995919-3023097 |
| NcPrimaryTranscript | Transcript:Y55D5A.5b | Y55D5A.5b |
6728
|
III: 2995919-3028702 |
Other
6 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:Y55D5A.5c | Y55D5A.5c |
5787
|
III: 2995919-2996014 |
| CDS:Y55D5A.5f | Y55D5A.5f |
3111
|
III: 2995919-2996014 |
| CDS:Y55D5A.5e | Y55D5A.5e |
5313
|
III: 2995919-2996014 |
| CDS:Y55D5A.5d | Y55D5A.5d |
5400
|
III: 2995919-2996014 |
| CDS:Y55D5A.5a | Y55D5A.5a |
5541
|
III: 2995919-2996014 |
| CDS:Y55D5A.5g | Y55D5A.5g |
2019
|
III: 2995919-2996014 |
156 RNAi Result
1515 Allele
| Public Name |
|---|
| gk962532 |
| gk964281 |
| otn11019 |
| otn12087 |
| WBVar01692284 |
| WBVar01692287 |
| WBVar01692288 |
| WBVar01692285 |
| WBVar01692286 |
| WBVar01692289 |
| WBVar01692290 |
| WBVar01692291 |
| WBVar01692292 |
| sa186 |
| sa187 |
| sa189 |
| sa193 |
| sa197 |
| sa219 |
| sa229 |
| sa230 |
| sa223 |
| sa231 |
| WBVar02068613 |
| WBVar02068614 |
| WBVar01260924 |
| WBVar01260923 |
| WBVar01260928 |
| WBVar01260927 |
| WBVar01260925 |
1 Chromosome Location
|
Feature . Primary Identifier |
Start | End | Strand |
|---|---|---|---|
| WBGene00000898 | 2994514 | 3040846 | -1 |
4 Data Sets
| Name | URL |
|---|---|
| WormBaseAcedbConverter | |
| GO Annotation data set | |
| C. elegans genomic annotations (GFF3 Gene) | |
| Panther orthologue and paralogue predictions |
1 Downstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrIII_2990058..2994513 | 4456 | III: 2990058-2994513 | Caenorhabditis elegans |
128 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. | DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. | WBPaper00060811:L1_vs_adult_upregulated_neural | |
| Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. | DESeq. False discovry rate (FDR) < 0.1. | WBPaper00048988:neuron_expressed | |
| Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). | A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. | WBPaper00037950:all-neurons_L1-larva_expressed | |
| mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. | Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. | WBPaper00045420:fertilization_downregulated_transcript | |
| Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). | A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. | WBPaper00037950:AVE-neuron_L1-larva_expressed | |
| Osmotic stress | Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present | DESeq(version 1.10.1), FDR < 0.05. | WBPaper00050726:OsmoticStress_regulated_Food |
| Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. | DESEQ2, fold change > 2 and FDR < 0.01. | WBPaper00062103:neuron_enriched | |
| Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:arcade_intestinal-valve_expressed | |
| Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:body-muscle_expressed | |
| Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:GABAergic-neuron_expressed | |
| Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:hypodermis_expressed | |
| Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:intestine_expressed | |
| Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:NMDA-neuron_expressed | |
| Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:pharynx_expressed | |
| Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade). | For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). | WBPaper00040858:eQTL_age_regulated_developing | |
| Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:seam_expressed | |
| Bacteria diet: Sphingomonas aquatilis Yellow. Fed for 30 generations. | Transcripts that showed significantly decreased expression after fed by bacteria Sphingomonas aquatilis (Yellow) for 30 generations comparing to animals fed by E. coli OP50. | DESeq2 fold change > 2, p-value < 0.01. | WBPaper00061007:S.aquatilis_downregulated |
| Bacteria infection: Bacillus thuringiensis | mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq. | Cuffdiff, ajusted p-value < 0.01. | WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h |
| mRNAs that showed differential expression in activated AAK-2(uthIs202[aak-2 (intron 1)::aak-2(aa1-aa321)::Tomato::unc-54 3'UTR + rol-6(su1006)]), activiated CRTC-1 (uthEx222[crtc-1p::crtc-1 cDNA (S76S, S179A)::tdTomato::unc-54 3'UTR + rol-6(su1006)]), or AAK-2;CRTC-1 comparing to in N2. | Genes were tested for differential expression between each mutant strain and wild-type using edgeRs glm method. Briefly, negative binomial models were fitted and dispersion estimates obtained. These were then used to calculate average levels of change between conditions and determine differential expression, using the generalized linear model likelihood ratio test. For each comparison, genes with less than 5 CPM were filtered and those with at least 50% change and False Discovery Rate (FDR) of 1% or less were considered differentially expressed. | WBPaper00046499:AMPK_regulated | |
| Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2. | DEseq 1.18.0, adjusted p-value < 0.05. | WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated | |
| Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure. | Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2). | DEseq 1.18.0, adjusted p-value < 0.05. | WBPaper00056471:S.aureus-4h_upregulated_N2 |
| Transcripts that showed significantly increased expression at the intestine cells of daf-2(e1370) comparing to the intestine cells of N2 animals at L2 larva stage. | DESeq2 (version 1.24.0), fold change >= 2, FDR < 0.05 | WBPaper00064632:daf-2(e1370)_upregulated_intestine | |
| 25C vs. 20C | Transcripts that showed significantly increased expression in 1-day post L4 adult hermaphrodite N2 grown at 25C, comparing to in N2 animals grown at 20C. | CuffDiff, fold change > 2. | WBPaper00065096:25C_vs_20C_upregulated |
| Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite N2 grown at 20C, comparing to in 1-day post L4 adult hermaphrodite N2 animals grown at 20C. | CuffDiff, fold change > 2. | WBPaper00065096:Day10_vs_Day1_upregulated | |
| Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy. | Cufflinks | WBPaper00065120:body-muscle-transcriptome | |
| Transcripts that showed significantly increased expression in xrep-4(lax137). | DESeq2. Genes were selected if their p value < 0.01. | WBPaper00066062:xrep-4(lax137)_upregulated | |
| Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in N2. | Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1. | WBPaper00053810:daf-2(e1370)_upregulated | |
| Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). | A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. | WBPaper00037950:coelomocytes_L2-larva_expressed | |
| Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). | A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. | WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed | |
| Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). | A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. | WBPaper00037950:GABAergic-motor-neurons_L2-larva_expressed |
22 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| No GO_term assigned. | Expr4269 | Expression of DAF-2::Venus was too weak to determine the precise localization | ||
| Expr1030562 | Tiling arrays expression graphs | |||
| Expr15703 | In dauer larva carrying the daf-2a/c reporter, fluorescence was detected in neurons and in the intestine. | |||
| Expr16363 | DAF-2::mNeonGreen was detected in neurons, XXX cells, vulval cells, germ cells, and oocytes. In the last three types of cells, DAF-2::mNeonGreen had clear plasma membrane (PM) localization as expected for a cell surface receptor. In the neurons and XXX cells, a pair of specialized hypodermal cells of neural endocrine function, strong DAF-2::mNeonGreen signals were seen in the cell bodies and along processes. The DAF-2::mNeonGreen-expressing neurons included all of the ciliated sensory neurons marked by the osm-6 promoter-driven mCherry protein. | |||
| Also expressed in (comments from author) : Mosaic population. Strain: BC14074 | [daf-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATTCCCATAAATTTGTGTGTGG] 3' and primer B 5' [ATTGATTCTCGTCATCGTTCTGT] 3'. | Expr7058 | Adult Expression: intestine; Nervous System; head neurons; Larval Expression: intestine; Nervous System; head neurons; | |
| Expr11750 | GFP expression driven by the Ce-daf-2 promoter was found predominantly in the intestine, amphidial/head neurons, including ASH, ADF and AWA and elsewhere in the nervous system -e.g. nerve ring. | |||
| Expr15701 | The daf-2b splicing reporter was highly expressed in the hypodermis and intestine of L1 and L2 larvae. | |||
| Expr16364 | This high-sensitivity daf-2 expression reporter was readily detectable in most C. elegans cells, including the ones that had been missed by the DAF-2::mNeonGreen fusion protein marker (Expr16363), that is, the intestine, hypodermis, gonadal sheath, and body wall muscles (BWM). With NuGFP, expression of daf-2 was observed starting in 2-cell embryos, and the expression continued throughout development and adulthood. Also expressed in head neurons, germ line, vulval cells, tail neurons, ciliated sensory neurons, XXX cells. | |||
| Expr13676 | DAF-2::GFP fusion protein was seen predominantly in the intestine, head neurons and elsewhere in the nervous system. | |||
| Expr15704 | ||||
| Expr15702 | Using the daf-2b splicing reporter in dauer larvae, we observed expression only in the nervous system. | |||
| Expr9913 | In indirect immunofluorescence experiments, the purified antibodies revealed DAF-2 in the cell bodies and processes of neurons, most obviously in the nerve ring, the major neuropil of the animal. DAF-2 was also expressed in the cell bodies of a pair of cells anterior to the nerve ring that were identified as XXXL/R, based on their variable positions relative to the nerve ring from animal to animal. No such immunofluorescence was observed in the daf-2(m646) null mutant, indicating that the antibodies are specific to DAF-2. Whereas the highest level of DAF-2 was present in the nervous system, we also observed weak immunofluorescence in other tissues, such as the hypodermis. We observed DAF-2 in the nerve ring from the mid-L1 stage to adulthood. | |||
| Expr9966 | daf-2 is enriched in the gonad. | |||
| Expr2010773 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Expr1018631 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | |||
| Expr1160950 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015 | |||
| Expr2029010 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Original chronogram file: chronogram.626.xml | [Y55D5A.5:gfp] transcriptional fusion. | Chronogram1706 | ||
| Expr11883 | In the salt-sensing neuron ASER, which is essential for taste avoidance learning, DAF-2a fused with Venus was mainly localized to the cell body. | |||
| Expr11884 | DAF-2c was strongly localized to the synapse-rich neurite that extends to the neuropil. | |||
| Expr15700 | daf-2b is present at all life stages and daf-2a is between 4 and 7 times more abundant than daf-2b. | |||
| Expr11339 | Analysis of the localization of GFP::DAF-2 in the germline reveals that GFP::DAF-2 localizes to the cell membrane, the cytoplasm, and cytoplasmic vesicles. |
88 GO Annotation
| Annotation Extension | Qualifier |
|---|---|
| part_of(WBbt:0005784) | located_in |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| part_of(WBbt:0005784) | located_in |
| located_in | |
| located_in | |
| part_of | |
| located_in | |
| located_in | |
| enables | |
| enables | |
| has_input(WB:WBGene00000912) | acts_upstream_of_negative_effect |
| has_input(WB:WBGene00000912) | acts_upstream_of_negative_effect |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| involved_in | |
| enables | |
| enables | |
| enables | |
| enables |
11 Homologues
| Type |
|---|
| orthologue |
| orthologue |
| orthologue |
| least diverged orthologue |
| least diverged orthologue |
| least diverged orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| least diverged orthologue |
88 Ontology Annotations
| Annotation Extension | Qualifier |
|---|---|
| part_of(WBbt:0005784) | located_in |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| part_of(WBbt:0005784) | located_in |
| located_in | |
| located_in | |
| part_of | |
| located_in | |
| located_in | |
| enables | |
| enables | |
| has_input(WB:WBGene00000912) | acts_upstream_of_negative_effect |
| has_input(WB:WBGene00000912) | acts_upstream_of_negative_effect |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| involved_in | |
| enables | |
| enables | |
| enables | |
| enables |
58 Regulates Expr Cluster
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression at the intestine cells of daf-2(e1370) comparing to the intestine cells of N2 animals at L2 larva stage. | DESeq2 (version 1.24.0), fold change >= 2, FDR < 0.05 | WBPaper00064632:daf-2(e1370)_upregulated_intestine | |
| Genes that showed significantly increased expression in daf-2(e1370);hel-1(gk148684) comparing to in hel-1(gk148684) | To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs. | WBPaper00047131:daf-2(e1370)_upregulated_hel-1(gk148684)-background | |
| Genes that showed significantly increased expression in daf-2(e1370) comparing to in N2. | To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs. | WBPaper00047131:daf-2(e1370)_upregulated_N2-background | |
| Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in control animals. | NOIseq(v2.34.0), fold change > = 1.5, Differentially expressed genes (DEGs) were defined as having a probability of differentialexpression > 95%. | WBPaper00064727:daf-2(e1370)_upregulated | |
| Transcripts that showed significantly increased expression in daf-2(e1370;mes-1(bn84ts) comparing to in mes-1(bn84ts). | DESeq2 was used for differential expression analysis. A BenjaminiHochberg multiple hypothesis-corrected P-value cutoff of 0.05 was used as a significance cutoff. | WBPaper00049368:daf-2(e1370)_upregulated | |
| Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in N2. | Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1. | WBPaper00053810:daf-2(e1370)_upregulated | |
| Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in N2. | Student's t-test, fold change > 2, p-value < 0.05. | WBPaper00055386:daf-2(e1370)_upregulated | |
| Proteins that showed increased expression in daf-2(e1370ts) comparing to in WT according to quantitative mass spectrometry proteomic analysis. | N.A. | WBPaper00030894:daf-2(e1370ts)_upregulated | |
| Transcripts up regulated in daf-2(e1370) comparing to in N2 when animals were grown at 15 degree and then at 25 degree for 12 hours. | To select nuclear-hormone-receptor mutants for the cold-tolerance test, authors set the q-value threshold at q < 0.05, except that nhr-88, 113, 145, 172 and 207 were picked up from the genes with q < 0.25 in comparing between 15C-cultivated wild-type and wild-type cultivated at 25C for 12 h after cultivation at 15C. | WBPaper00049736:daf-2(e1370)_upregulated_15deg-then-25deg(12hr) | |
| Genes with no change in hcf-1(-), no change in sir-2.1(O/E) and upregulated in daf-2(-). | To identify the genes that show consistent and significant expression changes across the independent biological replicates of hcf-1(-) or sir-2.1(O/E), authors used Significance Analysis of Microarrays (SAM) with a stringent criteria of expected false discovery rate (FDR) set at 0%. | WBPaper00040184:hcf-1nc_sir-2.1nc_daf-2up | |
| mRNAs that showed significantly decreased expression in polysomal fractions in daf-2(e1370) comparing to in daf-2(e1370);daf-16(mu86), according to RNAseq study. | Differentially expressed genes were determined using cuffdiff across all pairs. | WBPaper00046337:polysomal_daf-2_vs_daf-2;daf-16_downregulated | |
| mRNAs that showed significantly decreased expression in polysomal fractions in N2 comparing to in daf-2(e1370), according to RNAseq study. | Differentially expressed genes were determined using cuffdiff across all pairs. | WBPaper00046337:polysomal_N2_vs_daf-2_downregulated | |
| Genes with no change in hcf-1(-), no change in sir-2.1(O/E) and downregulated in daf-2(-). | To identify the genes that show consistent and significant expression changes across the independent biological replicates of hcf-1(-) or sir-2.1(O/E), authors used Significance Analysis of Microarrays (SAM) with a stringent criteria of expected false discovery rate (FDR) set at 0%. | WBPaper00040184:hcf-1nc_sir-2.1nc_daf-2down | |
| Transcripts that showed significantly decreased expression in daf-2(e1370) comparing to in N2. | Student's t-test, fold change > 2, p-value < 0.05. | WBPaper00055386:daf-2(e1370)_downregulated | |
| mRNAs that showed significantly increased expression in monosomal fractions in N2 comparing to in daf-2(e1370), according to RNAseq study. | Differentially expressed genes were determined using cuffdiff across all pairs. | WBPaper00046337:monosomal_N2_vs_daf-2_upregulated | |
| mRNAs that showed significantly increased expression in polysomal fractions in daf-2(e1370) comparing to in daf-2(e1370);daf-16(mu86), according to RNAseq study. | Differentially expressed genes were determined using cuffdiff across all pairs. | WBPaper00046337:polysomal_daf-2_vs_daf-2;daf-16_upregulated | |
| Transcripts that showed significantly decreased expression in daf-2(e1370) comparing to in N2. | Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1. | WBPaper00053810:daf-2(e1370)_downregulated | |
| Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in N2. | Limma version 3.24.15. Fold change < 0.67 (p < 0.05). | WBPaper00055827:daf-2(e1370)_upregulated | |
| Transcripts up regulated in the FACS isolated neurons from daf-16(mu86);daf-2(e1370), comparing to N2. | DESeq. differential expression was tested using the generalized linear model (GLM) likelihood ratio test, threshold for detection of DEGs was set at p-value < 0.05. | WBPaper00048988:daf-2(e1370)_daf-16(mu86)_upregulated_neuron | |
| Transcripts that showed significantly decreased expression in daf-2(e1370;mes-1(bn84ts) comparing to in mes-1(bn84ts). | DESeq2 was used for differential expression analysis. A BenjaminiHochberg multiple hypothesis-corrected P-value cutoff of 0.05 was used as a significance cutoff. | WBPaper00049368:daf-2(e1370)_downregulated | |
| Genes that showed significantly decreased expression in daf-2(e1370) comparing to in N2. | To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs. | WBPaper00047131:daf-2(e1370)_downregulated_N2-background | |
| Transcripts that showed significantly decreased expression in daf-2(e1370) comparing to in N2. | Limma version 3.24.15. Fold change < 0.67 (p < 0.05). | WBPaper00055827:daf-2(e1370)_downregulated | |
| Genes downregulated in hcf-1(-), downregulated in sir-2.1(O/E) and downregulated in daf-2(-). | To identify the genes that show consistent and significant expression changes across the independent biological replicates of hcf-1(-) or sir-2.1(O/E), authors used Significance Analysis of Microarrays (SAM) with a stringent criteria of expected false discovery rate (FDR) set at 0%. | WBPaper00040184:hcf-1down_sir-2.1down_daf-2down | |
| Genes differentially up-Regulated in e1370 compared to either m596 or e1368. | One-way ANOVA (p < 0.01) was performed to find genes that were statistically different between e1370 and the other two daf-2 alleles, m596 and e1368. | WBPaper00035504:daf-2(e1370)_upregulated | |
| Genes upregulated in hcf-1(-), upregulated in sir-2.1(O/E) and upregulated in daf-2(-). | To identify the genes that show consistent and significant expression changes across the independent biological replicates of hcf-1(-) or sir-2.1(O/E), authors used Significance Analysis of Microarrays (SAM) with a stringent criteria of expected false discovery rate (FDR) set at 0%. | WBPaper00040184:hcf-1up_sir-2.1up_daf-2up | |
| Transcripts that showed significantly decreased expression in daf-2(e1370) comparing to in control animals. | NOIseq(v2.34.0), fold change > = 1.5, Differentially expressed genes (DEGs) were defined as having a probability of differentialexpression > 95%. | WBPaper00064727:daf-2(e1370)_downregulated | |
| The cluster contains genes that are upregulated with daf-16 RNAi treatment and downregulated with daf-2 RNAi treatment and in daf-2 pathway mutants. | hierarchical clustering | [cgc5976]:class_2 | |
| Proteins with decreased expression in glp-4(bn2);daf-2(e1370) comparing to in glp-4(bn2) daf-16(mgDf50);daf-2(e1370) according to HPLC-MS proteomic analysis. | t-test | WBPaper00044128:daf-2(e1370)_downregulated | |
| Genes that are differentially expressed in daf-2(e1370) rsks-1(ok1255) to a greater extent than in daf-2 in a DAF-16-dependent manner. | A linear model was estimated for each gene to determine if the expression is significantly amplified in the daf-2 rsks-1 double mutant than in the daf-2 and rsks-1 single mutants. An empirical Bayes procedure was performed through the limma package to calculate a moderated t-statistic for each contrast of interest. The p-values were adjusted to control the false discovery rate (FDR) using the Benjamin-Hochberg (BH) procedure. | WBPaper00044638:daf-2(e1370)rsks-1(ok1255)_regulated | |
| Transcripts down regulated in daf-2(e1370) comparing to in N2 when animals were grown at 15 degree and then at 25 degree for 12 hours. | To select nuclear-hormone-receptor mutants for the cold-tolerance test, authors set the q-value threshold at q < 0.05, except that nhr-88, 113, 145, 172 and 207 were picked up from the genes with q < 0.25 in comparing between 15C-cultivated wild-type and wild-type cultivated at 25C for 12 h after cultivation at 15C. | WBPaper00049736:daf-2(e1370)_downregulated_15deg-then-25deg(12hr) |